Compare commits

...
408 Commits
Author SHA1 Message Date
antirez 6ad44b76b9 Use the special static refcount for stack objects. 2020-04-09 16:25:30 +02:00
antirez d88f52ee7d RDB: refactor some RDB loading code into dbAddRDBLoad(). 2020-04-09 16:21:48 +02:00
antirez 399a6b2b47 incrRefCount(): abort on statically allocated object. 2020-04-09 16:20:41 +02:00
antirez 451872527c More powerful DEBUG RELOAD.
Related to #3243.
2020-04-09 12:10:10 +02:00
antirez 3d5b2d41b5 RDB: clarify a condition in rdbLoadRio(). 2020-04-09 11:09:40 +02:00
antirez 30adc62232 RDB: load files faster avoiding useless free+realloc.
Reloading of the RDB generated by

    DEBUG POPULATE 5000000
    SAVE

is now 25% faster.

This commit also prepares the ability to have more flexibility when
loading stuff from the RDB, since we no longer use dbAdd() but can
control exactly how things are added in the database.
2020-04-09 10:24:46 +02:00
antirez 96688aa646 Fix ACL HELP table missing comma. 2020-04-08 10:56:47 +02:00
antirez a6350f717d Merge branch 'unstable' of github.com:/antirez/redis into unstable 2020-04-07 14:10:43 +02:00
antirez f69876280c Speedup INFO by counting client memory incrementally.
Related to #5145.

Design note: clients may change type when they turn into replicas or are
moved into the Pub/Sub category and so forth. Moreover the recomputation
of the bytes used is problematic for obvious reasons: it changes
continuously, so as a conservative way to avoid accumulating errors,
each client remembers the contribution it gave to the sum, and removes
it when it is freed or before updating it with the new memory usage.
2020-04-07 12:07:54 +02:00
Salvatore SanfilippoandGitHub e93dcba46e Merge pull request #7064 from mymilkbottles/unstable
Optimize lua log level judgment
2020-04-06 17:34:14 +02:00
Salvatore SanfilippoandGitHub 9a9109431b Merge pull request #7065 from qetu3790/unstable
fix comments about RESIZE DB opcode in rdb.c
2020-04-06 17:32:44 +02:00
antirez bb30b9f913 Clarify redis.conf comment about lazyfree-lazy-user-del. 2020-04-06 17:32:04 +02:00
Salvatore SanfilippoandGitHub 094b47391d Merge pull request #6243 from soloestoy/expand-lazy-free-server-del
lazyfree: add a new configuration lazyfree-lazy-user-del
2020-04-06 17:27:39 +02:00
qetu3790andGitHub 2c42f6a8b8 fix comments about RESIZE DB opcode in rdb.c
fix comments about RESIZE DB opcode in rdb.c
2020-04-06 20:52:32 +08:00
antirez 121c51f4f3 Merge branch 'lcs' into unstable 2020-04-06 13:51:55 +02:00
antirez af3c722fec LCS: more tests. 2020-04-06 13:51:49 +02:00
antirez ca8d6f1072 LCS: allow KEYS / STRINGS to be anywhere.
Initially they needed to be at the end so that we could extend to N
strings in the future, but after further consideration I no longer
believe it's worth it.
2020-04-06 13:48:31 +02:00
antirez 8dc28b6c75 LCS tests. 2020-04-06 13:45:37 +02:00
mymilkbottlesandGitHub 7bd5ccaad0 Merge pull request #1 from mymilkbottles/mymilkbottles-log-level-judge
Optimize lua log level judgment
2020-04-06 19:34:07 +08:00
antirez 7261a5550f LCS: get rid of STOREIDX option. Fix get keys helper. 2020-04-06 13:32:15 +02:00
mymilkbottlesandGitHub 25063f75d7 Judge the log level in advance 2020-04-06 19:27:06 +08:00
Salvatore SanfilippoandGitHub af5c11874c Merge pull request #6797 from patpatbear/issue_#6565_memory_borderline
Check OOM at script start to get stable lua OOM state.
2020-04-06 11:59:01 +02:00
Salvatore SanfilippoandGitHub 4bc4d2c767 Merge pull request #7063 from oranagra/oran-runtest-external
diffrent fix for runtest --host --port
2020-04-06 11:47:35 +02:00
Oran Agra cf3789f045 diffrent fix for runtest --host --port 2020-04-06 09:41:14 +03:00
Salvatore SanfilippoandGitHub b0bbfed238 Merge pull request #7051 from guybe7/sleep_in_blockonkeys_tests
Try to fix time-sensitive tests in blockonkey.tcl
2020-04-03 14:12:31 +02:00
Salvatore SanfilippoandGitHub c76d0e7be9 Merge pull request #7057 from guybe7/fix_attr_gnuc
Use __attribute__ only if __GNUC__ is defined
2020-04-03 13:52:24 +02:00
Guy Benoish 1b0d30aeb7 Try to fix time-sensitive tests in blockonkey.tcl
There is an inherent race between the deferring client and the
"main" client of the test: While the deferring client issues a blocking
command, we can't know for sure that by the time the "main" client
tries to issue another command (Usually one that unblocks the deferring
client) the deferring client is even blocked...
For lack of a better choice this commit uses TCL's 'after' in order
to give some time for the deferring client to issues its blocking
command before the "main" client does its thing.
This problem probably exists in many other tests but this commit
tries to fix blockonkeys.tcl
2020-04-03 14:51:45 +03:00
Guy Benoish a76a961cdd Use __attribute__ only if __GNUC__ is defined 2020-04-03 14:49:40 +03:00
Salvatore SanfilippoandGitHub f80b946bea Merge pull request #6855 from guybe7/var_funcs_format_check
Modules: Perform printf-like format checks in variadic API
2020-04-03 13:46:27 +02:00
Guy Benoish a8857320a5 Modules: Perform printf-like format checks in variadic API 2020-04-03 14:39:55 +03:00
Salvatore SanfilippoandGitHub cbf212f981 Merge pull request #7030 from valentinogeron/xread-in-lua
XREAD and XREADGROUP should not be allowed from scripts when BLOCK op…
2020-04-03 11:14:13 +02:00
Salvatore SanfilippoandGitHub 4158664d2b Merge pull request #6933 from guybe7/multi_exec_allow_stale
Stale replica should allow MULTI/EXEC
2020-04-03 11:12:58 +02:00
Salvatore SanfilippoandGitHub 4e8e7fb067 Merge pull request #7055 from zxdvd/patch-1
fix integer overflow
2020-04-03 11:10:26 +02:00
antirez ef610802c7 LCS: fix stale comment. 2020-04-02 21:17:31 +02:00
Salvatore SanfilippoandGitHub 5b73ea3cf6 Merge pull request #7054 from guybe7/fix_neg_zero_test
Fix no-negative-zero test
2020-04-02 20:00:51 +02:00
Salvatore SanfilippoandGitHub eb9ca33414 Merge pull request #6694 from oranagra/signal_modified_key
modules don't signalModifiedKey in setKey() since that's done (optionally) in RM_CloseKey
2020-04-02 19:00:20 +02:00
Xudong Zhang 78df016584 fix integer overflow 2020-04-02 23:43:47 +08:00
Guy Benoish 4665b3ebfb Fix no-negative-zero test 2020-04-02 18:41:29 +03:00
Guy Benoish 85a0d29d04 Stale replica should allow MULTI/EXEC
Example: Client uses a pipe to send the following to a
stale replica:

MULTI
.. do something ...
DISCARD

The replica will reply the MUTLI with -MASTERDOWN and
execute the rest of the commands... A client using a
pipe might not be aware that MULTI failed until it's
too late.

I can't think of a reason why MULTI/EXEC/DISCARD should
not be executed on stale replicas...

Also, enable MULTI/EXEC/DISCARD during loading
2020-04-02 18:23:59 +03:00
Salvatore SanfilippoandGitHub 416d394cd9 Merge pull request #6927 from oranagra/ci-moduleapi-tests
change CI to build and run the module api tests
2020-04-02 16:32:41 +02:00
Salvatore SanfilippoandGitHub 0062194d74 Merge pull request #6654 from oranagra/fix_module_info_warning
fix possible warning on incomplete struct init
2020-04-02 16:32:20 +02:00
Salvatore SanfilippoandGitHub 10b626b3d5 Merge pull request #6546 from guybe7/fix_neg_zero
Make sure Redis does not reply with negative zero
2020-04-02 16:26:57 +02:00
Salvatore SanfilippoandGitHub 2f53ad30ee Merge pull request #6813 from guybe7/debug_object_pass_keyname
DEBUG OBJECT should pass keyname to module when loading
2020-04-02 16:20:48 +02:00
antirez 5a3d85745a LCS: output LCS len as well in IDX mode. 2020-04-02 16:15:17 +02:00
antirez 3f96e1623d LCS: MINMATCHLEN and WITHMATCHLEN options. 2020-04-02 13:37:35 +02:00
Salvatore SanfilippoandGitHub 88351275fe Merge pull request #6960 from devnexen/debug_arm_linux
debug, dump registers on arm too.
2020-04-02 11:26:08 +02:00
Salvatore SanfilippoandGitHub fa4f50739a Merge pull request #7006 from hwware/fixspelling
fix spelling in cluster.c clusterDelNode
2020-04-02 11:23:53 +02:00
Salvatore SanfilippoandGitHub dfef407499 Merge pull request #7029 from valentinogeron/fix-xack
XACK should be executed in a "all or nothing" fashion.
2020-04-02 11:23:23 +02:00
Salvatore SanfilippoandGitHub 8d6dc136e1 Merge pull request #7041 from hwware/trackingfix
CLIENT TRACKING Command Fix: Add More Checking for OPTIN/OPTOUT mode
2020-04-02 11:22:30 +02:00
Salvatore SanfilippoandGitHub b73d87f5e5 Merge pull request #7039 from guybe7/persist_ksn
PERSIST should notify a keyspace event
2020-04-02 11:21:20 +02:00
Salvatore SanfilippoandGitHub babada8b5f Merge pull request #7042 from guybe7/stream_cg_last_id_fix
streamReplyWithRange: Redundant XSETIDs to replica
2020-04-02 11:20:54 +02:00
antirez 80ec0431e8 Simplify comment in moduleTryServeClientBlockedOnKey(). 2020-04-02 11:20:09 +02:00
antirez 545a5046f5 Merge branch 'unstable' of github.com:/antirez/redis into unstable 2020-04-02 11:18:33 +02:00
Salvatore SanfilippoandGitHub 10afb9639a Merge pull request #6798 from guybe7/module_circular_block
Fix memory corruption in moduleHandleBlockedClients
2020-04-02 11:17:29 +02:00
antirez 88e66ecf94 LCS: 7x speedup by accessing the array with better locality. 2020-04-01 23:45:07 +02:00
antirez 8cdc15c309 LCS: implement KEYS option. 2020-04-01 22:11:59 +02:00
antirez 4cbf3f5ddd LCS: other fixes to range emission. 2020-04-01 17:36:32 +02:00
antirez c9c03c3ee6 LCS: fix emission of last range starting at index 0. 2020-04-01 17:14:40 +02:00
antirez b3400559be LCS: implement range indexes option. 2020-04-01 17:11:31 +02:00
antirez 1010c1b43e LCS: initial functionality implemented. 2020-04-01 16:13:18 +02:00
Guy Benoish c4dc5b80b2 Fix memory corruption in moduleHandleBlockedClients
By using a "circular BRPOPLPUSH"-like scenario it was
possible the get the same client on db->blocking_keys
twice (See comment in moduleTryServeClientBlockedOnKey)

The fix was actually already implememnted in
moduleTryServeClientBlockedOnKey but it had a bug:
the funxction should return 0 or 1 (not OK or ERR)

Other changes:
1. Added two commands to blockonkeys.c test module (To
   reproduce the case described above)
2. Simplify blockonkeys.c in order to make testing easier
3. cast raxSize() to avoid warning with format spec
2020-04-01 12:53:26 +03:00
antirez 38076fd6ba cast raxSize() to avoid warning with format spec. 2020-03-31 17:41:46 +02:00
antirez 1d13ff0b39 Minor changes to #7037. 2020-03-31 17:10:09 +02:00
Salvatore SanfilippoandGitHub 0c52ce6c8e Merge pull request #7037 from guybe7/fix_module_replicate_multi
Modules: Test MULTI/EXEC replication of RM_Replicate
2020-03-31 17:00:57 +02:00
Salvatore SanfilippoandGitHub a20c206de7 Merge pull request #7048 from guybe7/rename_unblock_stream
RENAME can unblock XREADGROUP
2020-03-31 16:55:29 +02:00
Guy Benoish 6c8221580c RENAME can unblock XREADGROUP
Other changes:
Support stream in serverLogObjectDebugInfo
2020-03-31 17:41:10 +03:00
Guy Benoish d6eb3afd13 Modules: Test MULTI/EXEC replication of RM_Replicate
Makse sure call() doesn't wrap replicated commands with
a redundant MULTI/EXEC

Other, unrelated changes:
1. Formatting compiler warning in INFO CLIENTS
2. Use CLIENT_ID_AOF instead of UINT64_MAX
2020-03-31 13:55:51 +03:00
antirez 1b4bc60999 Merge branch 'pubsub_patterns_boost' of https://github.com/leeyiw/redis into leeyiw-pubsub_patterns_boost 2020-03-31 12:40:08 +02:00
antirez 4379b8b411 Fix the propagate Tcl test after module changes. 2020-03-31 12:09:38 +02:00
antirez 95f154985c Modify the propagate unit test to show more cases. 2020-03-31 12:04:06 +02:00
antirez 9dcf878f1b Fix module commands propagation double MULTI bug.
37a10cef introduced automatic wrapping of MULTI/EXEC for the
alsoPropagate API. However this collides with the built-in mechanism
already present in module.c. To avoid complex changes near Redis 6 GA
this commit introduces the ability to exclude call() MUTLI/EXEC wrapping
for also propagate in order to continue to use the old code paths in
module.c.
2020-03-31 11:00:45 +02:00
antirez 7698316fda Fix RM_Call() stale comment due to cut&paste. 2020-03-31 10:27:47 +02:00
antirez f6d5996ead Merge branch 'unstable' of github.com:/antirez/redis into unstable 2020-03-30 17:29:04 +02:00
antirez 3ef59b50c4 Precise timeouts: reference client pointer directly. 2020-03-30 15:22:59 +02:00
Guy Benoish 12d7479144 streamReplyWithRange: Redundant XSETIDs to replica
propagate_last_id is declared outside of the loop but used
only from within the loop. Once it's '1' it will never go
back to '0' and will replicate XSETID even for IDs that
don't actually change the last_id.
While not a serious bug (XSETID always used group->last_id
so there's no risk), it does causes redundant traffic
between master and its replicas
2020-03-30 10:53:03 +03:00
hwware 86c76cad74 add check for not switching between optin optout mode directly 2020-03-29 23:20:54 -04:00
hwware 1ef44f8243 add check for not providing both optin optout flag 2020-03-29 23:06:50 -04:00
Guy Benoish 3f0afab301 PERSIST should notify a keyspace event 2020-03-29 17:50:42 +03:00
Salvatore SanfilippoandGitHub aca7f36b57 Merge pull request #7033 from OMG-By/unstable
fix: dict.c->dictResize()->minimal  type
2020-03-29 16:17:52 +02:00
OMG-ByandGitHub 6d2f1188ac fix: dict.c->dictResize()->minimal type 2020-03-29 00:04:59 +08:00
Salvatore SanfilippoandGitHub e8afadd52c Merge pull request #7032 from soloestoy/psync2-meaningful-offset-bugfix
PSYNC2: reset backlog_idx and master_repl_offset correctly
2020-03-28 14:52:11 +01:00
zhaozhao.zz 36ee294e83 PSYNC2: reset backlog_idx and master_repl_offset correctly 2020-03-28 20:59:01 +08:00
antirez dd7e61d77f timeout.c created: move client timeouts code there. 2020-03-27 16:35:03 +01:00
antirez 0e22cb2680 Precise timeouts: cleaup the table on unblock.
Now that this mechanism is the sole one used for blocked clients
timeouts, it is more wise to cleanup the table when the client unblocks
for any reason. We use a flag: CLIENT_IN_TO_TABLE, in order to avoid a
radix tree lookup when the client was already removed from the table
because we processed it by scanning the radix tree.
2020-03-27 16:35:03 +01:00
antirez 13e4c2a9b1 Precise timeouts: fix comments after functional change. 2020-03-27 16:35:03 +01:00
antirez aa9d92d94a Precise timeouts: use only radix tree for timeouts. 2020-03-27 16:35:03 +01:00
antirez 077f965426 Precise timeouts: fast exit for clientsHandleShortTimeout(). 2020-03-27 16:35:03 +01:00
antirez 8d11e0df7a Precise timeouts: fix bugs in initial implementation. 2020-03-27 16:35:03 +01:00
antirez 324a8c91d0 Precise timeouts: working initial implementation. 2020-03-27 16:35:03 +01:00
antirez 8d116cc8a2 Precise timeouts: refactor unblocking on timeout. 2020-03-27 16:35:02 +01:00
antirez 97f1c808ce PSYNC2: fix backlog_idx when adjusting for meaningful offset
See #7002.
2020-03-27 16:20:02 +01:00
Valentino Geron 9a1843ef2d XREAD and XREADGROUP should not be allowed from scripts when BLOCK option is being used 2020-03-26 15:46:31 +02:00
Valentino Geron 1547d72cf3 XACK should be executed in a "all or nothing" fashion.
First, we must parse the IDs, so that we abort ASAP.
The return value of this command cannot be an error if
the client successfully acknowledged some messages,
so it should be executed in a "all or nothing" fashion.
2020-03-26 15:40:23 +02:00
Salvatore SanfilippoandGitHub 2ea7f0ecad Merge pull request #6644 from oranagra/stream_aofrw
AOFRW on an empty stream created with MKSTREAM loads badkly
2020-03-26 11:12:44 +01:00
Oran Agra 3b29556a0c AOFRW on an empty stream created with MKSTREAM loads badkly
the AOF will be loaded successfully, but the stream will be missing,
i.e inconsistencies with the original db.

this was because XADD with id of 0-0 would error.

add a test to reproduce.
2020-03-25 21:47:57 +02:00
antirez c4d7f30e25 PSYNC2: meaningful offset test. 2020-03-25 15:43:34 +01:00
antirez 57fa355e56 PSYNC2: meaningful offset implemented.
A very commonly signaled operational problem with Redis master-replicas
sets is that, once the master becomes unavailable for some reason,
especially because of network problems, many times it wont be able to
perform a partial resynchronization with the new master, once it rejoins
the partition, for the following reason:

1. The master becomes isolated, however it keeps sending PINGs to the
replicas. Such PINGs will never be received since the link connection is
actually already severed.
2. On the other side, one of the replicas will turn into the new master,
setting its secondary replication ID offset to the one of the last
command received from the old master: this offset will not include the
PINGs sent by the master once the link was already disconnected.
3. When the master rejoins the partion and is turned into a replica, its
offset will be too advanced because of the PINGs, so a PSYNC will fail,
and a full synchronization will be required.

Related to issue #7002 and other discussion we had in the past around
this problem.
2020-03-25 15:26:37 +01:00
antirez f15042dbf0 Explain why we allow transactions in -BUSY state.
Related to #7022.
2020-03-25 12:46:59 +01:00
Salvatore SanfilippoandGitHub 643bc48a00 Merge pull request #7022 from oranagra/multi-busy-script
MULTI/EXEC during LUA script timeout are messed up
2020-03-25 12:44:26 +01:00
Oran Agra ec007559ff MULTI/EXEC during LUA script timeout are messed up
Redis refusing to run MULTI or EXEC during script timeout may cause partial
transactions to run.

1) if the client sends MULTI+commands+EXEC in pipeline without waiting for
response, but these arrive to the shards partially while there's a busy script,
and partially after it eventually finishes: we'll end up running only part of
the transaction (since multi was ignored, and exec would fail).

2) similar to the above if EXEC arrives during busy script, it'll be ignored and
the client state remains in a transaction.

the 3rd test which i added for a case where MULTI and EXEC are ok, and
only the body arrives during busy script was already handled correctly
since processCommand calls flagTransaction
2020-03-23 20:45:32 +02:00
antirez c80d81c80a Improve comments of replicationCacheMasterUsingMyself(). 2020-03-23 16:17:35 +01:00
antirez 61de1c1146 Fix BITFIELD_RO test. 2020-03-23 12:02:12 +01:00
antirez 918086e253 Abort transactions after -READONLY error. Fix #7014. 2020-03-23 11:47:49 +01:00
antirez 38514e3c8d Minor changes to BITFIELD_RO PR #6951. 2020-03-23 11:28:09 +01:00
Salvatore SanfilippoandGitHub 493a7f9823 Merge pull request #6951 from yangbodong22011/feature-bitfield-ro
Added BITFIELD_RO variants for read-only operations.
2020-03-23 11:23:21 +01:00
antirez 19f5be231d Modules: updated function doc after #7003. 2020-03-23 11:17:50 +01:00
Salvatore SanfilippoandGitHub 7c5dc07016 Merge pull request #7003 from guybe7/rm_context_flags_handle_null
Allow RM_GetContextFlags to work with ctx==NULL
2020-03-23 11:15:42 +01:00
Salvatore SanfilippoandGitHub b9e5be5f56 Merge pull request #7005 from hwware/memoryleakfix-redis-cli
fix potential memory leak in redis-cli lua debug mode
2020-03-23 11:14:46 +01:00
Salvatore SanfilippoandGitHub 89f46f0fa1 Merge pull request #7018 from yossigo/fix-accept-issues
Fix issues with failed/rejected accepts.
2020-03-23 11:10:59 +01:00
Salvatore SanfilippoandGitHub d1788a5ddb Merge pull request #7019 from hwware/cscfix
Fix Bug for Client Side Caching: Unexpected Behaviour when Switching between OPTIN/OPTOUT Mode
2020-03-23 11:09:55 +01:00
hwware 34d5982bd5 remove redundant Semicolon 2020-03-23 01:07:46 -04:00
hwware a2732291cd clean CLIENT_TRACKING_CACHING flag when disabled caching 2020-03-23 01:04:49 -04:00
Yossi Gottlieb 2dab5015b7 Fix crashes related to failed/rejected accepts. 2020-03-22 14:47:44 +02:00
Yossi Gottlieb 4c08ae3ff6 Cluster: fix misleading accept errors. 2020-03-22 14:46:16 +02:00
Yossi Gottlieb fa9aa90813 Conns: Fix connClose() / connAccept() behavior.
We assume accept handlers may choose to reject a connection and close
it, but connAccept() callers can't distinguish between this state and
other error states requiring connClose().

This makes it safe (and mandatory!) to always call connClose() if
connAccept() fails, and safe for accept handlers to close connections
(which will defer).
2020-03-22 14:42:03 +02:00
Salvatore SanfilippoandGitHub 5634ee973c Merge pull request #7013 from hwware/clusterhelpfix
add missing commands description in cluster help
2020-03-20 16:33:10 +01:00
hwware 93bb42a0b5 add missing commands in cluster help 2020-03-20 09:01:12 -04:00
antirez 1e16b9384d Merge branch 'unstable' of github.com:/antirez/redis into unstable 2020-03-20 13:21:28 +01:00
antirez 5497a44037 Regression test for #7011. 2020-03-20 12:52:06 +01:00
antirez f9c56dbb09 ACL: default user off should not allow automatic authentication.
This fixes issue #7011.
2020-03-20 12:45:48 +01:00
hwware 262262fbb2 fix spelling in cluster.c 2020-03-18 09:48:03 -04:00
hwware 86691ccff5 fix potentical memory leak in redis-cli 2020-03-18 09:33:52 -04:00
Guy Benoish f16eaadd4f Allow RM_GetContextFlags to work with ctx==NULL 2020-03-18 18:34:27 +05:30
Salvatore SanfilippoandGitHub c1295bb9f1 Merge pull request #6996 from artix75/redis_cli_proxy_info
Support Redis Cluster Proxy PROXY INFO command
2020-03-18 11:06:49 +01:00
Salvatore SanfilippoandGitHub c52415b219 Merge pull request #7000 from ppillip/patch-1
Update redis.conf
2020-03-18 11:06:22 +01:00
Salvatore SanfilippoandGitHub 82e1807769 Merge pull request #7001 from trevor211/fixDataInconsistency
Fix data inconsistency
2020-03-18 11:04:08 +01:00
WuYunlong f6029fb925 Fix master replica inconsistency for upgrading scenario.
Before this commit, when upgrading a replica, expired keys will not
be loaded, thus causing replica having less keys in db. To this point,
master and replica's keys is logically consistent. However, before
the keys in master and replica are physically consistent, that is,
they have the same dbsize, if master got a problem and the replica
got promoted and becomes new master of that partition, and master
updates a key which does not exist on master, but physically exists
on the old master(new replica), the old master would refuse to update
the key, thus causing master and replica data inconsistent.

How could this happen?
That's all because of the wrong judgement of roles while starting up
the server. We can not use server.masterhost to judge if the server
is master or replica, since it fails in cluster mode.

When we start the server, we load rdb and do want to load expired keys,
and do not want to have the ability to active expire keys, if it is
a replica.
2020-03-18 16:22:07 +08:00
WuYunlong af5167b7f3 Add 14-consistency-check.tcl to prove there is a data consistency issue. 2020-03-18 16:17:46 +08:00
박승현andGitHub d9de9d5478 Update redis.conf 2020-03-18 14:40:50 +09:00
antirez b3a97004f4 Sentinel: document auth-user directive. 2020-03-16 17:11:43 +01:00
antirez 29b9d0a245 ACL: Make Redis 6 more backward compatible with requirepass.
Note that this as a side effect fixes Sentinel "requirepass" mode.
2020-03-16 16:57:12 +01:00
artix 771df8a436 Support Redis Cluster Proxy PROXY INFO command 2020-03-16 16:15:02 +01:00
antirez 9321c7871f Sentinel: implement auth-user directive for ACLs. 2020-03-16 15:59:34 +01:00
antirez bce9a68b39 Merge branch 'unstable' of github.com:/antirez/redis into unstable 2020-03-16 13:48:35 +01:00
antirez 8609e68161 Example sentinel conf: document requirepass. 2020-03-16 13:48:29 +01:00
Salvatore SanfilippoandGitHub 15338ab694 Merge pull request #6991 from soloestoy/io-threads-bugfix
Threaded IO: bugfix client kill may crash redis
2020-03-16 10:53:54 +01:00
Salvatore SanfilippoandGitHub f1e4af2c29 Merge pull request #6993 from soloestoy/optimize-threaded-io
Threaded IO: handle pending reads clients ASAP after event loop
2020-03-16 10:48:23 +01:00
zhaozhao.zz c46c76a399 Threaded IO: handle pending reads clients ASAP after event loop 2020-03-16 11:20:48 +08:00
zhaozhao.zz a6a0e05a1a Threaded IO: bugfix client kill may crash redis 2020-03-15 23:30:25 +08:00
antirez 573c4673ee Aesthetic changes in PR #6989. 2020-03-15 16:10:37 +01:00
Salvatore SanfilippoandGitHub 681c6f21b7 Merge pull request #6989 from soloestoy/io-threads-bugfix
Threaded IO: bugfix #6988 process events while blocked
2020-03-15 15:57:22 +01:00
zhaozhao.zz 606a01df70 Threaded IO: bugfix #6988 process events while blocked 2020-03-15 22:07:36 +08:00
antirez 453e01a091 Restore newline at the end of redis-cli.c 2020-03-13 16:21:55 +01:00
Salvatore SanfilippoandGitHub ebf1acd33c Merge pull request #6918 from chendq8/fixModuleUnregisterUsedApi
Fix module unregister used api
2020-03-13 12:46:27 +01:00
Salvatore SanfilippoandGitHub 0628030bf4 Merge pull request #6961 from guodongxiaren/pr
string literal should be const char*
2020-03-13 12:37:08 +01:00
Salvatore SanfilippoandGitHub cf6cbbb881 Merge pull request #6976 from itamarhaber/ksn-patch
Adds keyspace notifications to migrate and restore
2020-03-13 12:35:00 +01:00
Salvatore SanfilippoandGitHub 3c95c92b0f Merge pull request #6977 from yangbodong22011/fix-makefile-duplicate-obj
Remove duplicate obj files in Makefile
2020-03-13 12:32:03 +01:00
Salvatore SanfilippoandGitHub 22ae0ddf15 Merge pull request #6974 from yangbodong22011/fix-tcl-test-host-option
Fix bug of tcl test using external server
2020-03-13 12:27:26 +01:00
Salvatore SanfilippoandGitHub b1db7acf72 Merge pull request #6980 from fengpf/fix_latency_comments
fix comments in latency.c
2020-03-13 12:26:18 +01:00
antirez 5babacad9b Update linenoise. 2020-03-12 15:53:08 +01:00
fengpf a5f5091041 fix comments in latency.c 2020-03-12 20:44:32 +08:00
antirez 2091d73ef5 Merge branch 'unstable' of github.com:/antirez/redis into unstable 2020-03-12 13:25:01 +01:00
antirez 513931dfea ae.c: fix crash when resizing the event loop.
See #6964. The root cause is that the event loop may be resized from an
event callback itself, causing the event pointer to be invalid.
2020-03-12 13:24:30 +01:00
bodong.ybd 63c4697b46 Remove duplicate obj files in Makefile 2020-03-12 11:12:37 +08:00
Itamar Haber 7d703de7e9 Adds keyspace notifications to migrate and restore 2020-03-11 18:43:03 +02:00
bodong.ybd 336458d4b5 Fix bug of tcl test using external server 2020-03-11 21:01:27 +08:00
Salvatore SanfilippoandGitHub bd28dbee0e Merge pull request #6834 from lifubang/askpassword
add askpass mode
2020-03-10 16:51:36 +01:00
Salvatore SanfilippoandGitHub 2bd360feca Merge pull request #6950 from IAmATeaPot418/patch-2
Update Redis.conf to improve TLS usability
2020-03-10 16:47:06 +01:00
Jamie ScottandGitHub 374b1192a3 Remove default guidance in Redis.conf
Removing the default guidance in Redis.conf since this is not an available value.
2020-03-09 12:53:44 -07:00
guodongxiaren 106a57c5ae string literal should be const char* 2020-03-07 19:38:27 +08:00
David Carlier 6548157293 debug, dump registers on arm too. 2020-03-07 10:43:41 +00:00
Salvatore SanfilippoandGitHub 13707f988b Merge pull request #6687 from jtru/systemd-integration-fixes
Signal systemd readiness atfer Partial Resync
2020-03-06 13:15:10 +01:00
Salvatore SanfilippoandGitHub af347a8c86 Merge pull request #6954 from oranagra/fix-flaky-psync2-test
fix for flaky psync2 test
2020-03-05 16:12:21 +01:00
Oran Agra 27641ee490 fix for flaky psync2 test
*** [err]: PSYNC2: total sum of full synchronizations is exactly 4 in tests/integration/psync2.tcl
Expected 5 == 4 (context: type eval line 6 cmd {assert {$sum == 4}} proc ::test)

issue was that sometime the test got an unexpected full sync since it
tried to switch to the replica before it was in sync with it's master.
2020-03-05 16:55:14 +02:00
lifubang 1b72f4b749 add askpass mode
Signed-off-by: lifubang <lifubang@acmcoder.com>
2020-03-05 18:17:32 +08:00
lifubang 2b7b74ad68 update linenoise to https://github.com/antirez/linenoise/tree/fc9667a81d43911a6690fb1e68c16e6e3bb8df05
Signed-off-by: lifubang <lifubang@acmcoder.com>
2020-03-05 18:13:43 +08:00
antirez 45ee620e9c Merge branch 'unstable' of github.com:/antirez/redis into unstable 2020-03-05 10:54:51 +01:00
antirez 4983eb6a23 RDB deletion: document it in example redis.conf. 2020-03-04 17:58:05 +01:00
antirez 3bab69e921 Make sync RDB deletion configurable. Default to no. 2020-03-04 17:44:21 +01:00
bodong.ybd 94376f46ad Added BITFIELD_RO variants for read-only operations. 2020-03-04 20:51:45 +08:00
antirez d16bb64fa4 Check that the file exists in removeRDBUsedToSyncReplicas(). 2020-03-04 12:55:49 +01:00
antirez ff024e3064 Log RDB deletion in persistence-less instances. 2020-03-04 11:19:55 +01:00
antirez f0acdee4c5 Introduce bg_unlink(). 2020-03-04 11:10:54 +01:00
Jamie ScottandGitHub 2f3bfd1c13 Update Redis.conf to improve TLS usability
When using TLS with a Redis.conf file the line for TLS reading tls-cert-file redis.crt tls-key-file redis.key is interpreted as one complete directive. I am separating this on two separate lines to improve usability so users do not get the below error.

ubuntu@ip-172-31-29-250:~/redis-6.0-rc1$ ./src/redis-server redis.conf 

*** FATAL CONFIG FILE ERROR ***
Reading the configuration file, at line 145
>>> 'tls-cert-file redis.crt tls-key-file redis.key'
wrong number of arguments
ubuntu@ip-172-31-29-250:~/redis-6.0-rc1$ vi redis.conf 
ubuntu@ip-172-31-29-250:~/redis-6.0-rc1$ ./src/redis-server redis.conf 
23085:C 04 Mar 2020 01:58:12.631 # oO0OoO0OoO0Oo Redis is starting oO0OoO0OoO0Oo
23085:C 04 Mar 2020 01:58:12.631 # Redis version=5.9.101, bits=64, commit=00000000, modified=0, pid=23085, just started
23085:C 04 Mar 2020 01:58:12.631 # Configuration loaded
23085:M 04 Mar 2020 01:58:12.632 * Increased maximum number of open files to 10032 (it was originally set to 1024).
2020-03-03 18:03:16 -08:00
antirez 5e2319c326 Remove RDB files used for replication in persistence-less instances. 2020-03-03 14:58:15 +01:00
Salvatore SanfilippoandGitHub f88f8661ac Merge pull request #6804 from qetu3790/unstable
Fix not used constant in lru_test_mode.
2020-03-02 17:43:36 +01:00
Salvatore SanfilippoandGitHub d3e8f3fb62 Merge pull request #6923 from hwware/marcofix
add missing marco in sdsalloc.h
2020-03-02 17:07:41 +01:00
Salvatore SanfilippoandGitHub bd07f121b9 Merge pull request #6944 from ShooterIT/acl-compiler-warning
To avoid compiler warnings
2020-03-02 16:53:17 +01:00
antirez 6dd8de1774 Use a smaller getkeys global buffer.
The idea is that very few commands have a lot of keys, and when this
happens the allocation time becomes neglegible.
2020-03-02 16:49:11 +01:00
Salvatore SanfilippoandGitHub 7ca81170c7 Merge pull request #6836 from oranagra/opt_get_keys_malloc
Optimize temporary memory allocations for getKeysFromCommand mechanism
2020-03-02 16:48:05 +01:00
ShooterIT 98b23cce29 Avoid compiler warnings 2020-02-29 18:28:41 +08:00
antirez c8ae90fef6 Modules: reformat RM_Scan() top comment a bit. 2020-02-28 18:09:46 +01:00
antirez 8a3e9a6d44 Modules: more details in RM_Scan API top comment. 2020-02-28 18:06:30 +01:00
Salvatore SanfilippoandGitHub 86cbddc475 Merge pull request #6838 from oranagra/rm_scan_dict_rehash
RM_Scan disable dict rehashing
2020-02-28 17:47:52 +01:00
Salvatore SanfilippoandGitHub 4ccb56d0e6 Merge pull request #6828 from guybe7/module_string_from_double
Add RM_CreateStringFromDouble
2020-02-28 11:06:02 +01:00
Salvatore SanfilippoandGitHub d7f18f5019 Merge pull request #6862 from oranagra/command_info_no_auth
add no_auth to COMMAND INFO
2020-02-28 11:05:31 +01:00
Salvatore SanfilippoandGitHub f0d9a4e1a4 Merge pull request #6893 from oranagra/api_doc_aux_save
module api docs for aux_save and aux_load
2020-02-28 10:22:53 +01:00
antirez d4e375fc1e Merge branch 'unstable' of github.com:/antirez/redis into unstable 2020-02-27 18:22:22 +01:00
antirez 45f318d2ff Show Redis version when not understanding a config directive.
This makes simpler to give people help when posting such kind of errors
in the mailing list or other help forums, because sometimes the
directive looks well spelled, but the version of Redis they are using is
not able to support it.
2020-02-27 18:21:12 +01:00
Salvatore SanfilippoandGitHub cf31602bce Merge pull request #6677 from guybe7/deocde_id_once
streamReplyWithRangeFromConsumerPEL: Redundant streamDecodeID
2020-02-27 18:09:48 +01:00
Salvatore SanfilippoandGitHub 7e64aa80d8 Merge pull request #6690 from yangbodong22011/fix-spop-return-nil
Fix spop return nil #4709
2020-02-27 17:58:49 +01:00
antirez 9abdc089f8 Fix SDS misuse in enumConfigSet(). Related to #6778. 2020-02-27 17:51:30 +01:00
antirez 43f39f2e37 Remove useless comment from enumConfigSet(). 2020-02-27 17:45:56 +01:00
Salvatore SanfilippoandGitHub ec73881a4d Merge pull request #6778 from pponnuvel/fix_possible_overflow
Fix a potential overflow with strncpy
2020-02-27 17:45:02 +01:00
antirez d8ab7e8012 Improve aeDeleteEventLoop() top comment grammar. 2020-02-27 17:41:48 +01:00
Salvatore SanfilippoandGitHub e77db59660 Merge pull request #6189 from ShooterIT/del-event-loop
Del event loop
2020-02-27 17:40:51 +01:00
Salvatore SanfilippoandGitHub 652c532292 Merge pull request #6785 from patpatbear/issue_#6696_fix_aof_child_whitelist_SIGUSR1
fix impl of aof-child whitelist SIGUSR1 feature.
2020-02-27 17:39:33 +01:00
Oran Agra a477b68109 change CI to build and run the module api tests 2020-02-27 11:33:07 +02:00
Salvatore SanfilippoandGitHub ca825701dc Merge pull request #6876 from MeirShpilraien/changed_log_level_of_module_fork_api
Changed log level for module fork api from 'notice' to 'verbos'.
2020-02-27 10:26:55 +01:00
Salvatore SanfilippoandGitHub f7e05dc755 Merge pull request #6783 from hwware/memoryleakfix
Fix Memory Leaks in debug.c
2020-02-27 10:12:07 +01:00
Salvatore SanfilippoandGitHub 4f29753726 Merge pull request #6931 from t00350320/unstable
modify the read buf size according to the write buf size PROTO_IOBUF_LEN
2020-02-27 10:02:24 +01:00
Salvatore SanfilippoandGitHub 37612118c8 Merge pull request #6919 from ashtul/Fix-ThreadSafeContext-functions-names
fix ThreadSafeContext lock/unlock function names
2020-02-27 10:01:48 +01:00
Salvatore SanfilippoandGitHub 049969971e Merge pull request #6921 from guybe7/fix_xclaim_propagate
XREADGROUP should propagate XCALIM/SETID in MULTI/EXEC
2020-02-27 09:59:51 +01:00
Salvatore SanfilippoandGitHub d2c5f80e2e Merge pull request #6926 from oranagra/fork-test-fix
fix race in module api test for fork
2020-02-27 09:58:04 +01:00
Salvatore SanfilippoandGitHub 79de8f3c25 Merge pull request #6922 from guybe7/refix_blocked_module_memleak
Modules: Do not auto-unblock clients if not blocked on keys
2020-02-27 09:53:52 +01:00
Salvatore SanfilippoandGitHub 685dcaa1e6 Merge pull request #6935 from oranagra/ci_actions_latency
fix github actions failing latency test for active defrag - part 2
2020-02-27 09:52:40 +01:00
Oran Agra 2f1a1c3835 fix github actions failing latency test for active defrag - part 2
it seems that running two clients at a time is ok too, resuces action
time from 20 minutes to 10. we'll use this for now, and if one day it
won't be enough we'll have to run just the sensitive tests one by one
separately from the others.

this commit also fixes an issue with the defrag test that appears to be
very rare.
2020-02-27 08:34:53 +02:00
Salvatore SanfilippoandGitHub c913be0464 Merge pull request #6932 from oranagra/fix_defrag_latency_test
fix github actions failing latency test for active defrag
2020-02-25 19:20:52 +01:00
Oran Agra 537893420b fix github actions failing latency test for active defrag
seems that github actions are slow, using just one client to reduce
false positives.

also adding verbose, testing only on latest ubuntu, and building on
older one.

when doing that, i can reduce the test threshold back to something saner
2020-02-25 17:53:23 +02:00
Hengjian Tang 1ab5508324 modify the read buf size according to the write buf size PROTO_IOBUF_LEN defined before 2020-02-25 15:55:28 +08:00
antirez 319a6831a9 Merge branch 'unstable' of github.com:/antirez/redis into unstable 2020-02-24 19:10:13 +01:00
antirez 07acdd4aa8 Merge branch 'csc-optin' into unstable 2020-02-24 19:09:54 +01:00
antirez b6378edcd6 Tracking: optin/out implemented. 2020-02-24 19:09:45 +01:00
Salvatore SanfilippoandGitHub 3fbb41ecc9 Merge pull request #6920 from oranagra/defrag-test-latency-fix
Fix latency sensitivity of new defrag test
2020-02-24 11:53:32 +01:00
antirez 73305861f5 Test engine: experimental change to avoid busy port problems. 2020-02-24 10:46:23 +01:00
Oran Agra 0a643efa0c fix race in module api test for fork
in some cases we were trying to kill the fork before it got created
2020-02-23 16:48:37 +02:00
Guy Benoish 376a806bfb Modules: Do not auto-unblock clients if not blocked on keys 2020-02-23 19:36:46 +05:30
Guy Benoish a6c7e61e61 XREADGROUP should propagate XCALIM/SETID in MULTI/EXEC
Use built-in alsoPropagate mechanism that wraps commands
in MULTI/EXEC before sending them to replica/AOF
2020-02-23 19:13:15 +05:30
Oran Agra 62adabd0e0 Fix latency sensitivity of new defrag test
I saw that the new defag test for list was failing in CI recently, so i
reduce it's threshold from 12 to 60.

besides that, i add / improve the latency test for that other two defrag
tests (add a sensitive latency and digest / save checks)

and fix bad usage of debug populate (can't overrides existing keys).
this was the original intention, which creates higher fragmentation.
2020-02-23 13:05:52 +02:00
Ariel 28bde89172 fix ThreadSafeContext lock/unlock function names 2020-02-22 23:49:23 +02:00
hwware 743cfc0ad6 add missing file marco 2020-02-22 11:38:51 -05:00
chendianqiang 9947956d7b use correct list for moduleUnregisterUsedAPI 2020-02-22 15:03:01 +08:00
chendianqiangandGitHub 8341a7d472 Merge pull request #3 from antirez/unstable
update
2020-02-22 14:59:55 +08:00
antirez e78c4e813c Test engine: detect timeout when checking for Redis startup. 2020-02-21 18:55:56 +01:00
antirez c6954de3ea Test engine: better tracking of what workers are doing. 2020-02-21 17:08:45 +01:00
antirez 8a14fff545 Merge branch 'unstable' of github.com:/antirez/redis into unstable 2020-02-21 13:48:52 +01:00
antirez a8d70ac568 Test is more complex now, increase default timeout. 2020-02-21 13:48:43 +01:00
Salvatore SanfilippoandGitHub ab8c383082 Merge pull request #6901 from hwware/debughelp
add missing subcommand description for DEBUG OOM in HELP
2020-02-20 17:42:24 +01:00
Salvatore SanfilippoandGitHub c552fad6d4 Merge pull request #6864 from guybe7/fix_memleak_in_test_ld_conv
Fix memory leak in test_ld_conv
2020-02-20 13:08:31 +01:00
Salvatore SanfilippoandGitHub 155526a44e Merge pull request #6894 from madolson/csc-fixes
Client side caching fixes
2020-02-20 13:03:31 +01:00
Salvatore SanfilippoandGitHub e741b0c257 Merge pull request #6903 from oranagra/defrag_lists
Defrag big lists in portions to avoid latency and freeze
2020-02-20 13:00:39 +01:00
Salvatore SanfilippoandGitHub 9fe02ce1cd Merge pull request #6905 from guybe7/xgroup_destroy_unblock
XGROUP DESTROY should unblock XREADGROUP with -NOGROUP
2020-02-20 12:54:14 +01:00
Salvatore SanfilippoandGitHub 42c4d6aec7 Merge pull request #6911 from hayashier/fix-typo-fss
fix typo from fss to rss
2020-02-20 12:02:05 +01:00
antirez c8c78bd4b9 Tracking: fix max-keys configuration directive. 2020-02-19 19:00:29 +01:00
Guy Benoish 770cb0ba97 XGROUP DESTROY should unblock XREADGROUP with -NOGROUP 2020-02-19 08:25:31 +05:30
Oran Agra 485425cec7 Defrag big lists in portions to avoid latency and freeze
When active defrag kicks in and finds a big list, it will create a bookmark to
a node so that it is able to resume iteration from that node later.

The quicklist manages that bookmark, and updates it in case that node is deleted.

This will increase memory usage only on lists of over 1000 (see
active-defrag-max-scan-fields) quicklist nodes (1000 ziplists, not 1000 items)
by 16 bytes.

In 32 bit build, this change reduces the maximum effective config of
list-compress-depth and list-max-ziplist-size (from 32767 to 8191)
2020-02-18 17:22:32 +02:00
hwware 7d4ebe114f add missing subcommand description for debug oom 2020-02-17 23:40:24 -05:00
Oran Agra 6fff2cf9b6 module api docs for aux_save and aux_load 2020-02-16 15:43:19 +02:00
Madelyn Olson c1b5220ee7 Give an error message if you specify redirect twice 2020-02-16 05:41:39 -08:00
Madelyn Olson d63a435362 Minor CSC fixes and fixed documentation 2020-02-16 05:28:29 -08:00
antirez df45fed050 Merge branch 'unstable' of github.com:/antirez/redis into unstable 2020-02-14 18:23:13 +01:00
antirez 20eeddfb8a Signal key as modified when expired on-access.
This fixes WATCH and client side caching with keys expiring because of
a synchronous access and not because of background expiring.
2020-02-14 18:22:25 +01:00
Salvatore SanfilippoandGitHub ddb80bb3d4 Merge pull request #6890 from itamarhaber/patch-trackingGetTotalKeys
Fixes segfault on calling trackingGetTotalKeys
2020-02-14 16:21:24 +01:00
Itamar Haber 8a44b2cc7e Fixes segfault on calling trackingGetTotalKeys
... with CSC disabled
2020-02-14 17:13:58 +02:00
antirez 090bc0c1a3 Merge branch 'csc2' into unstable 2020-02-14 14:29:18 +01:00
antirez 8ea7a3ee68 Tracking: first set of tests for the feature. 2020-02-14 14:29:00 +01:00
antirez 47177c9edc Tracking: fix operators precedence error in bcast check. 2020-02-14 14:27:45 +01:00
antirez f6e32a832f Tracking: fix behavior when switchinig from normal to BCAST. 2020-02-14 14:27:43 +01:00
Salvatore SanfilippoandGitHub c21c23bbba Merge pull request #6863 from oranagra/module_commands_no_slowlog
add no-slowlog option to RM_CreateCommand
2020-02-13 17:02:19 +01:00
antirez 6922ccc0b9 Tracking: fix sending messages bug + tracking off bug. 2020-02-13 16:58:07 +01:00
antirez 40194a2a68 Tracking: BCAST: basic feature now works. 2020-02-12 19:22:04 +01:00
Salvatore SanfilippoandGitHub 8aa0b19d83 Merge pull request #6691 from kraj/fno-common
Mark extern definition of SDS_NOINIT in sds.h
2020-02-12 14:04:53 +01:00
Salvatore SanfilippoandGitHub f54bb2a330 Merge pull request #6882 from lifubang/userpass
correct help info for --user and --pass
2020-02-12 14:04:15 +01:00
lifubang dc8f947d7c correct help info for --user and --pass
Signed-off-by: lifubang <lifubang@acmcoder.com>
2020-02-12 16:34:22 +08:00
antirez 71f3f3f1af Tracking: BCAST: broadcasting of keys in prefixes implemented. 2020-02-11 18:11:59 +01:00
antirez 3f7ba86255 Tracking: BCAST: registration in the prefix table. 2020-02-11 17:26:29 +01:00
antirez dfe126f3e9 Tracking: BCAST: parsing of the options + skeleton. 2020-02-10 17:18:11 +01:00
antirez f53cc00c09 Tracking: always reply with an array of keys. 2020-02-10 13:42:18 +01:00
meir@redislabs.com 67dbc5f365 Changed log level for module fork api from 'notice' to 'verbos'. 2020-02-10 12:10:32 +02:00
Salvatore SanfilippoandGitHub 256ec6c52f Merge pull request #6875 from WOOSEUNGHOON/cve20158080_fix
[FIX] revisit CVE-2015-8080 vulnerability
2020-02-10 10:45:52 +01:00
Seunghoon Woo ef764dde1c [FIX] revisit CVE-2015-8080 vulnerability 2020-02-10 16:32:46 +09:00
antirez 85e4777d5c Tracking: minor change of names and new INFO field. 2020-02-07 18:12:45 +01:00
antirez 1ea6672430 Rax.c: populate data field after random walk. 2020-02-07 18:12:10 +01:00
antirez d933d6f2a4 Tracking: rename INFO field with total items. 2020-02-07 17:19:17 +01:00
antirez 92357b2d61 Tracking: first conversion from hashing to key names. 2020-02-07 14:03:43 +01:00
Oran Agra 46216b0e83 add no-slowlog option to RM_CreateCommand 2020-02-06 15:06:33 +02:00
Guy Benoish 5c73a6e206 Fix memory leak in test_ld_conv 2020-02-06 18:36:21 +05:30
Oran Agra c8c3281f06 add no_auth to COMMAND INFO 2020-02-06 14:53:54 +02:00
Salvatore SanfilippoandGitHub 9c00bdd86e Merge pull request #6822 from guybe7/diskless_load_module_hook_fix
Diskless-load emptyDb-related fixes
2020-02-06 13:10:00 +01:00
Guy Benoish 92dc5e1fa4 Diskless-load emptyDb-related fixes
1. Call emptyDb even in case of diskless-load: We want modules
   to get the same FLUSHDB event as disk-based replication.
2. Do not fire any module events when flushing the backups array.
3. Delete redundant call to signalFlushedDb (Called from emptyDb).
2020-02-06 16:48:02 +05:30
antirez 50d4326e3b Merge branch 'unstable' of github.com:/antirez/redis into unstable 2020-02-06 11:24:22 +01:00
antirez d5c6a833c8 Merge branch 'acl-log' into unstable 2020-02-06 11:24:16 +01:00
Salvatore SanfilippoandGitHub 1012514e0f Merge pull request #6826 from lifubang/opensslcli
fix ssl args check for redis-cli
2020-02-06 11:22:20 +01:00
Oran Agra 28ef18a894 RM_Scan disable dict rehashing
The callback approach we took is very efficient, the module can do any
filtering of keys without building any list and cloning strings, it can
also read data from the key's value. but if the user tries to re-open
the key, or any other key, this can cause dict re-hashing (dictFind does
that), and that's very bad to do from inside dictScan.

this commit protects the dict from doing any rehashing during scan, but
also warns the user not to attempt any writes or command calls from
within the callback, for fear of unexpected side effects and crashes.
2020-02-06 11:48:12 +02:00
Salvatore SanfilippoandGitHub 5bfba06a3b Merge pull request #6821 from guybe7/key_miss_notify
Exclude "keymiss" notification from NOTIFY_ALL
2020-02-06 10:43:05 +01:00
Salvatore SanfilippoandGitHub 2e1dd00c80 Merge pull request #6837 from oranagra/signal_modified_key_doc
update RM_SignalModifiedKey doc comment
2020-02-06 10:38:36 +01:00
Salvatore SanfilippoandGitHub 730cacf672 Merge pull request #6840 from oranagra/short_read_moduleid
Add handling of short read of module id in rdb
2020-02-06 10:35:42 +01:00
Salvatore SanfilippoandGitHub 4abba65ec7 Merge pull request #6841 from yossigo/tls-doc-update
TLS: Update documentation.
2020-02-06 10:35:21 +01:00
Salvatore SanfilippoandGitHub 33f613bf87 Merge pull request #6843 from oranagra/command_flags
A few non-data commands that should be allowed while loading or stale
2020-02-06 10:34:26 +01:00
Salvatore SanfilippoandGitHub 4aafdb185a Merge pull request #6844 from oranagra/bind_config_leak
Memory leak when bind config is provided twice
2020-02-06 10:33:40 +01:00
Salvatore SanfilippoandGitHub be520829b8 Merge pull request #6845 from oranagra/maxmemory_warning
fix maxmemory config warning
2020-02-06 10:33:15 +01:00
Salvatore SanfilippoandGitHub 13741fb99d Merge pull request #6846 from oranagra/module_client_flags
Fix client flags to be int64 in module.c
2020-02-06 10:32:35 +01:00
Salvatore SanfilippoandGitHub 08b218bfa5 Merge pull request #6847 from oranagra/module_read_err_panic
moduleRDBLoadError, add key name, and use panic rather than exit
2020-02-06 10:31:29 +01:00
Salvatore SanfilippoandGitHub 5558c0e4cf Merge pull request #6848 from oranagra/opt_use_diskless_load_calls
reduce repeated calls to use_diskless_load
2020-02-06 10:30:39 +01:00
Salvatore SanfilippoandGitHub 7cf53252ee Merge pull request #6849 from oranagra/free_client_mutex
freeClientAsync don't lock mutex if there's just one thread
2020-02-06 10:29:46 +01:00
Salvatore SanfilippoandGitHub 44266d6d92 Merge pull request #6850 from oranagra/restart_aof_unset_master
move restartAOFAfterSYNC from replicaofCommand to replicationUnsetMaster
2020-02-06 10:27:05 +01:00
Salvatore SanfilippoandGitHub 58a3a3fa68 Merge pull request #6851 from oranagra/aof_rewrite_scheduled
stopAppendOnly resets aof_rewrite_scheduled
2020-02-06 10:23:11 +01:00
Salvatore SanfilippoandGitHub 711b13801e Merge pull request #6852 from oranagra/acl_help
add SAVE subcommand to ACL HELP and top comment
2020-02-06 10:22:16 +01:00
Salvatore SanfilippoandGitHub f25962337d Merge pull request #6853 from oranagra/debug_help
DEBUG HELP - add PROTOCOL
2020-02-06 10:21:55 +01:00
Salvatore SanfilippoandGitHub 15c7f1317e Merge pull request #6854 from guybe7/mem_overhead_miscalc
Fix small bugs related to replica and monitor ambiguity
2020-02-06 10:21:30 +01:00
Guy Benoish 91c41b6dde Some refactroing using getClientType instead of CLIENT_SLAVE 2020-02-06 14:12:08 +05:30
Oran Agra 31ffbf1133 DEBUG HELP - add PROTOCOL 2020-02-06 10:40:29 +02:00
Guy Benoish e33fffbde1 Fix small bugs related to replica and monitor ambiguity
1. server.repl_no_slaves_since can be set when a MONITOR client disconnects
2. c->repl_ack_time can be set by a newline from a MONITOR client
3. Improved comments
2020-02-06 14:10:02 +05:30
Oran Agra 6d29c34da7 add SAVE subcommand to ACL HELP and top comment 2020-02-06 10:31:43 +02:00
Oran Agra 69e8ea7143 stopAppendOnly resets aof_rewrite_scheduled
althouh in theory, users can do BGREWRITEAOF even if aof is disabled, i
suppose it is more common that the scheduled flag is set by either
startAppendOnly, of a failed initial AOFRW fork (AOF_WAIT_REWRITE)
2020-02-06 10:17:34 +02:00
Oran Agra aac6a4cf13 move restartAOFAfterSYNC from replicaofCommand to replicationUnsetMaster
replicationUnsetMaster can be called from other places, not just
replicaofCOmmand, and all of these need to restart AOF
2020-02-06 10:14:32 +02:00
Oran Agra 86e302f5f3 freeClientAsync don't lock mutex if there's just one thread 2020-02-06 10:07:17 +02:00
Oran Agra 485d5d4a18 reduce repeated calls to use_diskless_load
this function possibly iterates on the module list
2020-02-06 09:41:45 +02:00
Oran Agra 85cc696f50 moduleRDBLoadError, add key name, and use panic rather than exit
using panic rather than exit means you get s stack trace of the code
path that experianced the error, and possibly other info.
2020-02-06 09:37:04 +02:00
Oran Agra d454d5a4f5 Fix client flags to be int64 in module.c
currently there's no bug since the flags these functions handle are
always lower than 32bit, but still better fix the type to prevent future
bugs.
2020-02-06 09:33:20 +02:00
Oran Agra a17bddf2a1 fix maxmemory config warning
the warning condition was if usage > limit (saying it'll cause eviction
or oom), but in fact the eviction and oom depends on used minus slave
buffers.

other than fixing the condition, i add info about the current usage and
limit, which may be useful when looking at the log.
2020-02-06 09:23:22 +02:00
Oran Agra 7e1d5954e5 Memory leak when bind config is provided twice 2020-02-06 09:17:39 +02:00
Oran Agra ac2c96f5b1 A few non-data commands that should be allowed while loading or stale
SELECT, and HELLO are commands that may be executed by the client
as soon as it connects, there's no reason to block them, preventing the
client from doing the rest of his sequence (which might just be INFO or
CONFIG, etc).

MONITOR, DEBUG, SLOWLOG, TIME, LASTSAVE are all non-data accessing
commands, which there's no reason to block.
2020-02-06 08:53:23 +02:00
Yossi Gottlieb bb3d45a386 TLS: Update documentation. 2020-02-05 21:19:03 +02:00
Oran Agra fe7e8dc955 Add handling of short read of module id in rdb 2020-02-05 19:47:09 +02:00
Salvatore SanfilippoandGitHub edfe1b2f8b Merge pull request #6839 from yossigo/fix/redis-conf-tls-clarifications
TLS: Some redis.conf clarifications.
2020-02-05 17:33:21 +01:00
Yossi Gottlieb 1e02d599dc TLS: Some redis.conf clarifications. 2020-02-05 18:30:12 +02:00
Oran Agra 3795aaf42a update RM_SignalModifiedKey doc comment 2020-02-05 18:15:38 +02:00
Oran Agra 774d8cd721 Optimize temporary memory allocations for getKeysFromCommand mechanism
now that we may use it more often (ACL), these excessive calls to malloc
and free can become an overhead.
2020-02-05 18:06:33 +02:00
Salvatore SanfilippoandGitHub 44ac202fbf Merge pull request #6831 from oranagra/config_c_refactor_3
config.c verbose error replies for CONFIG SET, like config file parsing
2020-02-05 13:41:15 +01:00
Salvatore SanfilippoandGitHub 4abf0e1e10 Merge pull request #6829 from oranagra/memory_get_keys
memoryGetKeys helper function so that ACL can limit access to keys for MEMORY command
2020-02-05 13:33:18 +01:00
Oran Agra ffdd0620d0 config.c verbose error replies for CONFIG SET, like config file parsing
We noticed that the error replies for the generic mechanism for enums
are very verbose for config file parsing, but not for config set
command.

instead of replicating this code, i did a small refactoring to share
code between CONFIG SET and config file parsing.

and also renamed the enum group functions to be consistent with the
naming of other types.
2020-02-05 11:41:24 +02:00
Oran Agra 9ac6cb9ce4 memoryGetKeys helper function so that ACL can limit access to keys for MEMORY command 2020-02-05 09:42:49 +02:00
Guy Benoish 1c7a2269d6 Add RM_CreateStringFromDouble 2020-02-04 19:28:09 +05:30
antirez 90fae58b49 ACL LOG: make max log entries configurable. 2020-02-04 13:19:40 +01:00
antirez 64a73e9293 ACL LOG: test for AUTH reason. 2020-02-04 12:58:48 +01:00
antirez 0c1a4b5576 ACL LOG: log failed auth attempts. 2020-02-04 12:55:26 +01:00
lifubang 540b917a26 fix ssl flag check for redis-cli
Signed-off-by: lifubang <lifubang@acmcoder.com>
2020-02-04 17:32:30 +08:00
Salvatore SanfilippoandGitHub cfe39b7859 Merge pull request #6818 from leomurillo/zskiplistLevels
Set ZSKIPLIST_MAXLEVEL to 32
2020-02-04 10:20:56 +01:00
Salvatore SanfilippoandGitHub 6ca1ad1e27 Merge pull request #6825 from trevor211/fixMemoryLeakAboutLuaScript
Fix memory leak about lua script
2020-02-04 10:19:16 +01:00
WuYunlong eb2196f5ce Fix lua related memory leak. 2020-02-04 16:38:46 +08:00
WuYunlong 01eaf53bb3 Add tcl regression test in scripting.tcl to reproduce memory leak. 2020-02-04 16:34:11 +08:00
Salvatore SanfilippoandGitHub 2400f5782e Merge pull request #6808 from yossigo/fix/redis-cli-openssl-1.0.x
TLS: Fix missing initialization in redis-cli.
2020-02-03 16:43:56 +01:00
Salvatore SanfilippoandGitHub 726abe4deb Merge pull request #6824 from oranagra/fix_module_c_uninit_var
fix uninitialized info_cb var in module.c
2020-02-03 15:46:13 +01:00
Oran Agra 138ed120dd fix uninitialized info_cb var in module.c 2020-02-03 16:35:39 +02:00
Guy Benoish 2fda5f5c98 Exclude "keymiss" notification from NOTIFY_ALL
Because "keymiss" is "special" compared to the rest of
the notifications (Trying not to break existing apps
using the 'A' format for notifications)

Also updated redis.conf and module.c docs
2020-02-03 15:43:44 +05:30
Leo Murillo 560e1e6c4b Set ZSKIPLIST_MAXLEVEL to optimal value given 2^64 elements and p=0.25 2020-02-02 02:48:00 -06:00
Salvatore SanfilippoandGitHub 53ac8c7df2 Merge pull request #6812 from guybe7/str_convert_fix
ld2string should fail if string contains \0 in the middle
2020-01-30 17:51:04 +01:00
Guy Benoish d72b7ed4fb DEBUG OBJECT should pass keyname to module when loading 2020-01-30 19:15:12 +05:30
Guy Benoish 2deb55512f ld2string should fail if string contains \0 in the middle
This bug affected RM_StringToLongDouble and HINCRBYFLOAT.
I added tests for both cases.

Main changes:
1. Fixed string2ld to fail if string contains \0 in the middle
2. Use string2ld in getLongDoubleFromObject - No point of
   having duplicated code here

The two changes above broke RM_SaveLongDouble/RM_LoadLongDouble
because the long double string was saved with length+1 (An innocent
mistake, but it's actually a bug - The length passed to
RM_SaveLongDouble should not include the last \0).
2020-01-30 18:15:17 +05:30
antirez b189a21974 ACL LOG: implement a few basic tests. 2020-01-30 11:14:13 +01:00
antirez 396161765b ACL LOG: also log ACL errors in the scripting/MULTI ctx. 2020-01-30 10:50:32 +01:00
Yossi Gottlieb 93edb3ff3a TLS: Fix missing initialization in redis-cli. 2020-01-29 21:40:02 +02:00
antirez 30a466ba38 ACL LOG: implement LOG RESET. 2020-01-29 18:51:04 +01:00
antirez 6671032faf ACL LOG: group similar entries in a given time delta. 2020-01-29 18:40:32 +01:00
antirez 17ff3173d6 Add more info in the unblockClientFromModule() function. 2020-01-29 12:47:50 +01:00
Salvatore SanfilippoandGitHub bf53f9280a Merge pull request #6699 from guybe7/module_blocked_on_key_timeout_memleak
Modules: Fix blocked-client-related memory leak
2020-01-29 12:06:14 +01:00
antirez 61dffd8669 ACL LOG: actually emit entries. 2020-01-28 18:04:20 +01:00
antirez e8d0057710 ACL LOG: implement ACL LOG subcommadn skeleton. 2020-01-28 17:30:50 +01:00
antirez 3e9e27e98f ACL LOG: data structures and initial functions. 2020-01-27 18:37:52 +01:00
qetu3790andGitHub 6f2240aefd Merge pull request #1 from qetu3790/qetu3790-patch-1
Fix not used constant in lru_test_mode.
2020-01-23 17:30:35 +08:00
qetu3790andGitHub bd60c11bd8 Fix not used constant in lru_test_mode.
LRU_CYCLE_PERIOD is defined,but not used.
2020-01-23 17:18:07 +08:00
srzhao 38f6207f88 Check OOM at script start to get stable lua OOM state.
Checking OOM by `getMaxMemoryState` inside script might get different result
with `freeMemoryIfNeededAndSafe` at script start, because lua stack and
arguments also consume memory.

This leads to memory `borderline` when memory grows near server.maxmemory:

- `freeMemoryIfNeededAndSafe` at script start detects no OOM, no memory freed
- `getMaxMemoryState` inside script detects OOM, script aborted

We solve this 'borderline' issue by saving OOM state at script start to get
stable lua OOM state.

related to issue #6565 and #5250.
2020-01-20 21:34:05 +08:00
srzhao dd05b7f67f fix impl of aof-child whitelist SIGUSR1 feature. 2020-01-17 11:50:51 +08:00
hwware 67ee87522a format fix 2020-01-16 17:35:26 -05:00
hwware 3f6d00d387 fix potentical memory leaks 2020-01-16 17:33:23 -05:00
antirez 7ef2270ee7 Change error message for #6775. 2020-01-15 17:55:24 +01:00
Salvatore SanfilippoandGitHub 456bbc02c8 Merge pull request #6775 from SqREL/make-error-of-invalid-command-withing-context-explicit
Make error when submitting command in incorrect context more explicit
2020-01-15 17:53:51 +01:00
Ponnuvel Palaniyappan 1d4ea00d12 Fix a potential overflow with strncpy 2020-01-14 08:10:39 +00:00
antirez 2d7dc71b6f Document I/O threads in redis.conf. 2020-01-13 19:10:42 +01:00
antirez 7d5fb5df3f Setting N I/O threads should mean N-1 additional + 1 main thread. 2020-01-13 18:53:36 +01:00
antirez 28d146bed6 Simplify #6379 changes. 2020-01-13 13:25:37 +01:00
Salvatore SanfilippoandGitHub 9506c860f6 Merge pull request #6739 from trevor211/fixMemoryLeak
Fix potential memory leak of rioWriteBulkStreamID().
2020-01-13 13:23:49 +01:00
antirez baa88a1c14 Jump to right label on AOF parsing error.
Related to #6054.
2020-01-13 13:16:15 +01:00
antirez d28948b143 Port PR #6110 to new connection object code. 2020-01-13 12:54:39 +01:00
antirez a8c912ead6 A few comments about main thread serving I/O as well.
Related to #6110.
2020-01-13 12:50:26 +01:00
Salvatore SanfilippoandGitHub 24896427fc Merge pull request #6110 from soloestoy/enhance-io-threaded
Enhance IO Threaded: use main thread to handle read/write work
2020-01-13 12:46:40 +01:00
Vasyl Melnychuk b5f52bf01c Make error when submitting command in incorrect context more explicit
So error message `ERR only (P)SUBSCRIBE / (P)UNSUBSCRIBE / PING / QUIT allowed in this context` will become
`ERR 'get' command submitted, but only (P)SUBSCRIBE / (P)UNSUBSCRIBE / PING / QUIT allowed in this context`
2020-01-10 23:34:15 +02:00
antirez 8105f91a02 Merge branch 'unstable' of github.com:/antirez/redis into unstable 2020-01-10 13:15:36 +01:00
Salvatore SanfilippoandGitHub b8b8dd5c15 Merge pull request #6114 from ShooterIT/async-rename-rdb
Rename rdb when replica finish receiving rdb asynchronously
2020-01-10 13:06:39 +01:00
antirez 9466dae4e5 Free fakeclient argv on AOF error.
We exit later, so no bug fixed, but it is more correct.

See #6054, thanks to @ShooterIT for finding the issue.
2020-01-10 13:02:45 +01:00
antirez 5234bff579 Git ignore: ignore more files. 2020-01-10 12:22:16 +01:00
Salvatore SanfilippoandGitHub 51a01ca8a6 Merge pull request #6746 from leomurillo/unstable
Fix bug on KEYS command where pattern starts with * followed by \x00
2020-01-10 12:18:19 +01:00
Salvatore SanfilippoandGitHub b8d315ff76 Merge pull request #6457 from IAmATeaPot418/patch-1
Update to directive in redis.conf (missing s)
2020-01-10 12:16:13 +01:00
Salvatore SanfilippoandGitHub bb93686754 Merge pull request #6703 from guybe7/blocking_xread_empty_reply
Blocking XREAD[GROUP] should always reply with valid data (or timeout)
2020-01-09 17:32:14 +01:00
Salvatore SanfilippoandGitHub 64ef0ad71a Merge pull request #6724 from JohnSully/incremental
Add support for incremental build with header files
2020-01-09 17:10:02 +01:00
Salvatore SanfilippoandGitHub 0f3c353dd3 Merge pull request #6715 from trevor211/fixPotentialClusterLinkError
Fix petential cluster link error.
2020-01-09 17:05:54 +01:00
Salvatore SanfilippoandGitHub f616ecf361 Merge pull request #6698 from yossigo/ctx-flags-multi-dirty
Add REDISMODULE_CTX_FLAGS_MULTI_DIRTY.
2020-01-08 13:09:48 +01:00
Salvatore SanfilippoandGitHub 2ee4f9f34e Merge pull request #6748 from hwware/typofix
typo fix in acl.c
2020-01-08 13:06:06 +01:00
Salvatore SanfilippoandGitHub c89ec5af1e Merge pull request #6735 from itamarhaber/io-threads
Adjusts 'io_threads_num' max in config.c
2020-01-08 12:50:13 +01:00
Salvatore SanfilippoandGitHub 0e38c5f39c Merge pull request #6743 from yz1509/unstable
Sentinel: avoid sentinel changes promoted_slave to be its own replica.
2020-01-08 12:30:49 +01:00
antirez 7080a28efc XCLAIM: Create the consumer only on successful claims.
Fixes #6744.
2020-01-08 10:10:11 +01:00
hwware fda2bf9c92 typo fix in acl.c 2020-01-07 21:09:44 -05:00
Leo Murillo 63e46e5f8d Fix bug on KEYS command where pattern starts with * followed by \x00 (null char). 2020-01-07 13:55:26 -06:00
WuYunlong d6a13f4440 Free allocated sds in pfdebugCommand() to avoid memory leak. 2020-01-07 11:17:52 +08:00
yz1509 18c2676084 avoid sentinel changes promoted_slave to be its own replica. 2020-01-07 10:29:54 +08:00
WuYunlong 9387f7333e Fix potential memory leak of clusterLoadConfig(). 2020-01-07 10:28:36 +08:00
WuYunlong 2f8134a7ff Fix potential memory leak of rioWriteBulkStreamID(). 2020-01-06 19:58:13 +08:00
Itamar Haber 408e8e9f44 Adjusts 'io_threads_num' max to 128
Instead of 512, use the defined max from networking.c
2020-01-04 18:33:24 +02:00
antirez 0af467d18f Fix active expire division by zero.
Likely fix #6723.

This is what happens AFAIK: we enter the main loop where we expire stuff
until a given percentage of keys is still found to be logically expired.
There are however other potential exit conditions.

However the "sampled" variable is not always incremented inside the
loop, because we may found no valid slot as we scan the hash table, but
just NULLs ad dict entries. So when the do/while loop condition is
triggered at the end, we do (expired*100/sampled), dividing by zero if
we sampled 0 keys.
2020-01-01 18:13:13 +01:00
John Sully e5565a793e Add support for incremental build with header files 2020-01-01 10:33:02 -05:00
ShooterITandShooterIT 2bc8db9ca5 Rename rdb asynchronously 2019-12-31 21:45:32 +08:00
wangyuan21 3848849013 free time event when delete eventloop 2019-12-31 19:57:02 +08:00
WuYunlong 0992ada2fe Fix petential cluster link error.
Funcion adjustOpenFilesLimit() has an implicit parameter, which is server.maxclients.
This function aims to ajust maximum file descriptor number according to server.maxclients
by best effort, which is "bestlimit" could be lower than "maxfiles" but greater than "oldlimit".
When we try to increase "maxclients" using CONFIG SET command, we could increase maximum
file descriptor number to a bigger value without calling aeResizeSetSize the same time.
When later more and more clients connect to server, the allocated fd could be bigger and bigger,
and eventually exceeds events size of aeEventLoop.events. When new nodes joins the cluster,
new link is created, together with new fd, but when calling aeCreateFileEvent, we did not
check the return value. In this case, we have a non-null "link" but the associated fd is not
registered.

So when we dynamically set "maxclients" we could reach an inconsistency between maximum file
descriptor number of the process and server.maxclients. And later could cause cluster link and link
fd inconsistency.

While setting "maxclients" dynamically, we consider it as failed when resulting "maxclients" is not
the same as expected. We try to restore back the maximum file descriptor number when we failed to set
"maxclients" to the specified value, so that server.maxclients could act as a guard as before.
2019-12-31 18:16:30 +08:00
hayashier a3b0d8631f fix typo from fss to rss 2019-12-31 17:46:48 +09:00
Guy Benoish d7d13721d3 Modules: Fix blocked-client-related memory leak
If a blocked module client times-out (or disconnects, unblocked
by CLIENT command, etc.) we need to call moduleUnblockClient
in order to free memory allocated by the module sub-system
and blocked-client private data

Other changes:
Made blockedonkeys.tcl tests a bit more aggressive in order
to smoke-out potential memory leaks
2019-12-30 10:10:59 +05:30
Guy Benoish a351e74fe9 Blocking XREAD[GROUP] should always reply with valid data (or timeout)
This commit solves the following bug:
127.0.0.1:6379> XGROUP CREATE x grp $ MKSTREAM
OK
127.0.0.1:6379> XADD x 666 f v
"666-0"
127.0.0.1:6379> XREADGROUP GROUP grp Alice BLOCK 0 STREAMS x >
1) 1) "x"
   2) 1) 1) "666-0"
         2) 1) "f"
            2) "v"
127.0.0.1:6379> XADD x 667 f v
"667-0"
127.0.0.1:6379> XDEL x 667
(integer) 1
127.0.0.1:6379> XREADGROUP GROUP grp Alice BLOCK 0 STREAMS x >
1) 1) "x"
   2) (empty array)

The root cause is that we use s->last_id in streamCompareID
while we should use the last *valid* ID
2019-12-30 10:06:01 +05:30
antirez 6e4f70b817 Fix duplicated CLIENT SETNAME reply.
Happened when we set the name to "" to cancel the name.
Was introduced during the RESP3 refactoring.

See #6036.
2019-12-29 15:44:59 +01:00
antirez faea46710c Merge branch 'unstable' of github.com:/antirez/redis into unstable 2019-12-29 15:42:08 +01:00
antirez 5521910de7 Inline protocol: handle empty strings well.
This bug is from the first version of Redis. Probably the problem here
is that before we used an SDS split function that created empty strings
for additional spaces, like in "SET    foo          bar".
AFAIK later we replaced it with the curretn sdssplitarg() API that has
no such a problem. As a result, we introduced a bug, where it is no
longer possible to do something like:

    SET foo ""

Using the inline protocol. Now it is fixed.
2019-12-29 15:40:40 +01:00
Salvatore SanfilippoandGitHub 3ff95d9074 Merge pull request #6706 from guybe7/stream_id_edge_cases
Stream: Handle streamID-related edge cases
2019-12-29 14:53:06 +01:00
Salvatore SanfilippoandGitHub 1bae5dfff6 Merge pull request #6707 from oranagra/fix_config_limits
config.c adjust config limits and mutable
2019-12-29 14:51:40 +01:00
Oran Agra 0c3fe52ef7 config.c adjust config limits and mutable
- make lua-replicate-commands mutable (it never was, but i don't see why)
- make tcp-backlog immutable (fix a recent refactory mistake)
- increase the max limit of a few configs to match what they were before
the recent refactory
2019-12-26 15:16:15 +02:00
Guy Benoish 1f75ce30df Stream: Handle streamID-related edge cases
This commit solves several edge cases that are related to
exhausting the streamID limits: We should correctly calculate
the succeeding streamID instead of blindly incrementing 'seq'
This affects both XREAD and XADD.

Other (unrelated) changes:
Reply with a better error message when trying to add an entry
to a stream that has exhausted last_id
2019-12-26 15:31:37 +05:30
Yossi Gottlieb 0c898bdb07 Add REDISMODULE_CTX_FLAGS_MULTI_DIRTY. 2019-12-23 19:43:51 +02:00
Oran Agra 660645c742 modules don't signalModifiedKey in setKey() since that's done (optionally) in RM_CloseKey 2019-12-23 10:15:52 +02:00
Khem Raj af02478ba0 Mark extern definition of SDS_NOINIT in sds.h
This helps in avoiding multiple definition of this variable, its also
defined globally in sds.c

Signed-off-by: Khem Raj <raj.khem@gmail.com>
2019-12-21 11:47:31 -08:00
bodong.ybd 337dcde9fa Fix spop return nil #4709 2019-12-21 21:27:38 +08:00
antirez 324e22accf Fix ip and missing mode in RM_GetClusterNodeInfo(). 2019-12-20 12:29:02 +01:00
Johannes Truschnigg dfb598cf33 Signal systemd readiness atfer Partial Resync
"Partial Resynchronization" is a special variant of replication success
that we have to tell systemd about if it is managing redis-server via a
Type=Notify service unit.
2019-12-19 21:47:24 +01:00
zhaozhao.zz 3c0ed0309a lazyfree: add a new configuration lazyfree-lazy-user-del
Delete keys in async way when executing DEL command, if
lazyfree-lazy-user-del is yes.
2019-12-18 16:54:49 +08:00
Guy Benoish 5e0fe4c77c streamReplyWithRangeFromConsumerPEL: Redundant streamDecodeID 2019-12-18 12:27:37 +05:30
Oran Agra 173cca5413 fix possible warning on incomplete struct init 2019-12-10 11:16:13 +02:00
Guy Benoish 8beec4f0e7 Make sure Redis does not reply with negative zero 2019-11-05 19:23:37 +05:30
Jamie ScottandGitHub 45af2b1742 Update to directive in redis.conf (missing s)
The directive tls-prefer-server-cipher is actually tls-prefer-server-ciphers in config.c. This results in a failed directive call shown below. This pull request adds the "s" in ciphers so that the directive is able to be properly called in config.c

ubuntu@ip-172-31-16-31:~/redis$ src/redis-server ./redis.conf 

*** FATAL CONFIG FILE ERROR ***
Reading the configuration file, at line 200
>>> 'tls-prefer-server-cipher yes'
Bad directive or wrong number of arguments
2019-10-16 13:31:19 -07:00
zhaozhao.zz 1398fac3f1 Threaded IO: use main thread to handle read work 2019-05-21 11:42:10 +08:00
zhaozhao.zz 8b33975944 Threaded IO: use main thread to handle write work 2019-05-21 11:37:13 +08:00
伯成 dfb12f0628 Boost up performance for redis PUB-SUB patterns matching
If lots of clients PSUBSCRIBE to same patterns, multiple pattens matching will take place. This commit change it into just one single pattern matching by using a `dict *` to store the unique pattern and which clients subscribe to it.
2018-03-01 11:46:56 +08:00
83 changed files with 4141 additions and 1041 deletions
+13 -10
View File
@@ -3,11 +3,8 @@ name: CI
on: [push, pull_request]
jobs:
build-ubuntu:
strategy:
matrix:
platform: [ubuntu-latest, ubuntu-16.04]
runs-on: ${{ matrix.platform }}
test-ubuntu-latest:
runs-on: ubuntu-latest
steps:
- uses: actions/checkout@v1
- name: make
@@ -15,13 +12,19 @@ jobs:
- name: test
run: |
sudo apt-get install tcl8.5
make test
./runtest --clients 2 --verbose
- name: module api test
run: ./runtest-moduleapi --clients 2 --verbose
build-ubuntu-old:
runs-on: ubuntu-16.04
steps:
- uses: actions/checkout@v1
- name: make
run: make
build-macos-latest:
strategy:
matrix:
platform: [macos-latest, macOS-10.14]
runs-on: ${{ matrix.platform }}
runs-on: macos-latest
steps:
- uses: actions/checkout@v1
- name: make
+4
View File
@@ -1,5 +1,8 @@
.*.swp
*.o
*.xo
*.so
*.d
*.log
dump.rdb
redis-benchmark
@@ -29,3 +32,4 @@ deps/lua/src/liblua.a
*.dSYM
Makefile.dep
.vscode/*
.idea/*
+18
View File
@@ -35,6 +35,11 @@ It is as simple as:
% make
To build with TLS support, you'll need OpenSSL development libraries (e.g.
libssl-dev on Debian/Ubuntu) and run:
% make BUILD_TLS=yes
You can run a 32 bit Redis binary using:
% make 32bit
@@ -43,6 +48,13 @@ After building Redis, it is a good idea to test it using:
% make test
If TLS is built, running the tests with TLS enabled (you will need `tcl-tls`
installed):
% ./utils/gen-test-certs.sh
% ./runtest --tls
Fixing build problems with dependencies or cached build options
---------
@@ -125,6 +137,12 @@ as options using the command line. Examples:
All the options in redis.conf are also supported as options using the command
line, with exactly the same name.
Running Redis with TLS:
------------------
Please consult the [TLS.md](TLS.md) file for more information on
how to use Redis with TLS.
Playing with Redis
------------------
+14 -31
View File
@@ -1,8 +1,5 @@
TLS Support -- Work In Progress
===============================
This is a brief note to capture current thoughts/ideas and track pending action
items.
TLS Support
===========
Getting Started
---------------
@@ -69,37 +66,23 @@ probably not be so hard. For cluster keys migration it might be more difficult,
but there are probably other good reasons to improve that part anyway.
To-Do List
==========
----------
Additional TLS Features
-----------------------
- [ ] Add session caching support. Check if/how it's handled by clients to
assess how useful/important it is.
- [ ] redis-benchmark support. The current implementation is a mix of using
hiredis for parsing and basic networking (establishing connections), but
directly manipulating sockets for most actions. This will need to be cleaned
up for proper TLS support. The best approach is probably to migrate to hiredis
async mode.
- [ ] redis-cli `--slave` and `--rdb` support.
1. Add metrics to INFO?
2. Add session caching support. Check if/how it's handled by clients to assess
how useful/important it is.
redis-benchmark
---------------
The current implementation is a mix of using hiredis for parsing and basic
networking (establishing connections), but directly manipulating sockets for
most actions.
This will need to be cleaned up for proper TLS support. The best approach is
probably to migrate to hiredis async mode.
redis-cli
---------
1. Add support for TLS in --slave and --rdb modes.
Others
------
Multi-port
----------
Consider the implications of allowing TLS to be configured on a separate port,
making Redis listening on multiple ports.
making Redis listening on multiple ports:
This impacts many things, like
1. Startup banner port notification
2. Proctitle
3. How slaves announce themselves
+24 -1
View File
@@ -21,7 +21,7 @@ So what usually happens is either:
The result is a pollution of binaries without line editing support.
So I spent more or less two hours doing a reality check resulting in this little library: is it *really* needed for a line editing library to be 20k lines of code? Apparently not, it is possibe to get a very small, zero configuration, trivial to embed library, that solves the problem. Smaller programs will just include this, supporing line editing out of the box. Larger programs may use this little library or just checking with configure if readline/libedit is available and resorting to Linenoise if not.
So I spent more or less two hours doing a reality check resulting in this little library: is it *really* needed for a line editing library to be 20k lines of code? Apparently not, it is possibe to get a very small, zero configuration, trivial to embed library, that solves the problem. Smaller programs will just include this, supporting line editing out of the box. Larger programs may use this little library or just checking with configure if readline/libedit is available and resorting to Linenoise if not.
## Terminals, in 2010.
@@ -126,6 +126,24 @@ Linenoise has direct support for persisting the history into an history
file. The functions `linenoiseHistorySave` and `linenoiseHistoryLoad` do
just that. Both functions return -1 on error and 0 on success.
## Mask mode
Sometimes it is useful to allow the user to type passwords or other
secrets that should not be displayed. For such situations linenoise supports
a "mask mode" that will just replace the characters the user is typing
with `*` characters, like in the following example:
$ ./linenoise_example
hello> get mykey
echo: 'get mykey'
hello> /mask
hello> *********
You can enable and disable mask mode using the following two functions:
void linenoiseMaskModeEnable(void);
void linenoiseMaskModeDisable(void);
## Completion
Linenoise supports completion, which is the ability to complete the user
@@ -222,3 +240,8 @@ Sometimes you may want to clear the screen as a result of something the
user typed. You can do this by calling the following function:
void linenoiseClearScreen(void);
## Related projects
* [Linenoise NG](https://github.com/arangodb/linenoise-ng) is a fork of Linenoise that aims to add more advanced features like UTF-8 support, Windows support and other features. Uses C++ instead of C as development language.
* [Linenoise-swift](https://github.com/andybest/linenoise-swift) is a reimplementation of Linenoise written in Swift.
+5
View File
@@ -55,6 +55,7 @@ int main(int argc, char **argv) {
*
* The typed string is returned as a malloc() allocated string by
* linenoise, so the user needs to free() it. */
while((line = linenoise("hello> ")) != NULL) {
/* Do something with the string. */
if (line[0] != '\0' && line[0] != '/') {
@@ -65,6 +66,10 @@ int main(int argc, char **argv) {
/* The "/historylen" command will change the history len. */
int len = atoi(line+11);
linenoiseHistorySetMaxLen(len);
} else if (!strncmp(line, "/mask", 5)) {
linenoiseMaskModeEnable();
} else if (!strncmp(line, "/unmask", 7)) {
linenoiseMaskModeDisable();
} else if (line[0] == '/') {
printf("Unreconized command: %s\n", line);
}
+29 -3
View File
@@ -125,6 +125,7 @@ static linenoiseHintsCallback *hintsCallback = NULL;
static linenoiseFreeHintsCallback *freeHintsCallback = NULL;
static struct termios orig_termios; /* In order to restore at exit.*/
static int maskmode = 0; /* Show "***" instead of input. For passwords. */
static int rawmode = 0; /* For atexit() function to check if restore is needed*/
static int mlmode = 0; /* Multi line mode. Default is single line. */
static int atexit_registered = 0; /* Register atexit just 1 time. */
@@ -197,6 +198,19 @@ FILE *lndebug_fp = NULL;
/* ======================= Low level terminal handling ====================== */
/* Enable "mask mode". When it is enabled, instead of the input that
* the user is typing, the terminal will just display a corresponding
* number of asterisks, like "****". This is useful for passwords and other
* secrets that should not be displayed. */
void linenoiseMaskModeEnable(void) {
maskmode = 1;
}
/* Disable mask mode. */
void linenoiseMaskModeDisable(void) {
maskmode = 0;
}
/* Set if to use or not the multi line mode. */
void linenoiseSetMultiLine(int ml) {
mlmode = ml;
@@ -485,6 +499,8 @@ void refreshShowHints(struct abuf *ab, struct linenoiseState *l, int plen) {
if (bold == 1 && color == -1) color = 37;
if (color != -1 || bold != 0)
snprintf(seq,64,"\033[%d;%d;49m",bold,color);
else
seq[0] = '\0';
abAppend(ab,seq,strlen(seq));
abAppend(ab,hint,hintlen);
if (color != -1 || bold != 0)
@@ -523,7 +539,11 @@ static void refreshSingleLine(struct linenoiseState *l) {
abAppend(&ab,seq,strlen(seq));
/* Write the prompt and the current buffer content */
abAppend(&ab,l->prompt,strlen(l->prompt));
abAppend(&ab,buf,len);
if (maskmode == 1) {
while (len--) abAppend(&ab,"*",1);
} else {
abAppend(&ab,buf,len);
}
/* Show hits if any. */
refreshShowHints(&ab,l,plen);
/* Erase to right */
@@ -577,7 +597,12 @@ static void refreshMultiLine(struct linenoiseState *l) {
/* Write the prompt and the current buffer content */
abAppend(&ab,l->prompt,strlen(l->prompt));
abAppend(&ab,l->buf,l->len);
if (maskmode == 1) {
unsigned int i;
for (i = 0; i < l->len; i++) abAppend(&ab,"*",1);
} else {
abAppend(&ab,l->buf,l->len);
}
/* Show hits if any. */
refreshShowHints(&ab,l,plen);
@@ -645,7 +670,8 @@ int linenoiseEditInsert(struct linenoiseState *l, char c) {
if ((!mlmode && l->plen+l->len < l->cols && !hintsCallback)) {
/* Avoid a full update of the line in the
* trivial case. */
if (write(l->ofd,&c,1) == -1) return -1;
char d = (maskmode==1) ? '*' : c;
if (write(l->ofd,&d,1) == -1) return -1;
} else {
refreshLine(l);
}
+2
View File
@@ -65,6 +65,8 @@ int linenoiseHistoryLoad(const char *filename);
void linenoiseClearScreen(void);
void linenoiseSetMultiLine(int ml);
void linenoisePrintKeyCodes(void);
void linenoiseMaskModeEnable(void);
void linenoiseMaskModeDisable(void);
#ifdef __cplusplus
}
+6 -4
View File
@@ -89,12 +89,14 @@ typedef struct Header {
} Header;
static int getnum (const char **fmt, int df) {
static int getnum (lua_State *L, const char **fmt, int df) {
if (!isdigit(**fmt)) /* no number? */
return df; /* return default value */
else {
int a = 0;
do {
if (a > (INT_MAX / 10) || a * 10 > (INT_MAX - (**fmt - '0')))
luaL_error(L, "integral size overflow");
a = a*10 + *((*fmt)++) - '0';
} while (isdigit(**fmt));
return a;
@@ -115,9 +117,9 @@ static size_t optsize (lua_State *L, char opt, const char **fmt) {
case 'f': return sizeof(float);
case 'd': return sizeof(double);
case 'x': return 1;
case 'c': return getnum(fmt, 1);
case 'c': return getnum(L, fmt, 1);
case 'i': case 'I': {
int sz = getnum(fmt, sizeof(int));
int sz = getnum(L, fmt, sizeof(int));
if (sz > MAXINTSIZE)
luaL_error(L, "integral size %d is larger than limit of %d",
sz, MAXINTSIZE);
@@ -150,7 +152,7 @@ static void controloptions (lua_State *L, int opt, const char **fmt,
case '>': h->endian = BIG; return;
case '<': h->endian = LITTLE; return;
case '!': {
int a = getnum(fmt, MAXALIGN);
int a = getnum(L, fmt, MAXALIGN);
if (!isp2(a))
luaL_error(L, "alignment %d is not a power of 2", a);
h->align = a;
+87 -18
View File
@@ -142,7 +142,8 @@ tcp-keepalive 300
# server to connected clients, masters or cluster peers. These files should be
# PEM formatted.
#
# tls-cert-file redis.crt tls-key-file redis.key
# tls-cert-file redis.crt
# tls-key-file redis.key
# Configure a DH parameters file to enable Diffie-Hellman (DH) key exchange:
#
@@ -155,29 +156,27 @@ tcp-keepalive 300
# tls-ca-cert-file ca.crt
# tls-ca-cert-dir /etc/ssl/certs
# If TLS/SSL clients are required to authenticate using a client side
# certificate, use this directive.
# By default, clients (including replica servers) on a TLS port are required
# to authenticate using valid client side certificates.
#
# Note: this applies to all incoming clients, including replicas.
# It is possible to disable authentication using this directive.
#
# tls-auth-clients yes
# tls-auth-clients no
# If TLS/SSL should be used when connecting as a replica to a master, enable
# this configuration directive:
# By default, a Redis replica does not attempt to establish a TLS connection
# with its master.
#
# Use the following directive to enable TLS on replication links.
#
# tls-replication yes
# If TLS/SSL should be used for the Redis Cluster bus, enable this configuration
# directive.
#
# NOTE: If TLS/SSL is enabled for Cluster Bus, mutual authentication is always
# enforced.
# By default, the Redis Cluster bus uses a plain TCP connection. To enable
# TLS for the bus protocol, use the following directive:
#
# tls-cluster yes
# Explicitly specify TLS versions to support. Allowed values are case insensitive
# and include "TLSv1", "TLSv1.1", "TLSv1.2", "TLSv1.3" (OpenSSL >= 1.1.1) or
# "default" which is currently >= TLSv1.1.
# and include "TLSv1", "TLSv1.1", "TLSv1.2", "TLSv1.3" (OpenSSL >= 1.1.1)
#
# tls-protocols TLSv1.2
@@ -197,7 +196,7 @@ tcp-keepalive 300
# When choosing a cipher, use the server's preference instead of the client
# preference. By default, the server follows the client's preference.
#
# tls-prefer-server-cipher yes
# tls-prefer-server-ciphers yes
################################# GENERAL #####################################
@@ -322,6 +321,19 @@ rdbchecksum yes
# The filename where to dump the DB
dbfilename dump.rdb
# Remove RDB files used by replication in instances without persistence
# enabled. By default this option is disabled, however there are environments
# where for regulations or other security concerns, RDB files persisted on
# disk by masters in order to feed replicas, or stored on disk by replicas
# in order to load them for the initial synchronization, should be deleted
# ASAP. Note that this option ONLY WORKS in instances that have both AOF
# and RDB persistence disabled, otherwise is completely ignored.
#
# An alternative (and sometimes better) way to obtain the same effect is
# to use diskless replication on both master and replicas instances. However
# in the case of replicas, diskless is not always an option.
rdb-del-sync-files no
# The working directory.
#
# The DB will be written inside this directory, with the filename specified
@@ -931,13 +943,66 @@ replica-priority 100
# In all the above cases the default is to delete objects in a blocking way,
# like if DEL was called. However you can configure each case specifically
# in order to instead release memory in a non-blocking way like if UNLINK
# was called, using the following configuration directives:
# was called, using the following configuration directives.
lazyfree-lazy-eviction no
lazyfree-lazy-expire no
lazyfree-lazy-server-del no
replica-lazy-flush no
# It is also possible, for the case when to replace the user code DEL calls
# with UNLINK calls is not easy, to modify the default behavior of the DEL
# command to act exactly like UNLINK, using the following configuration
# directive:
lazyfree-lazy-user-del no
################################ THREADED I/O #################################
# Redis is mostly single threaded, however there are certain threaded
# operations such as UNLINK, slow I/O accesses and other things that are
# performed on side threads.
#
# Now it is also possible to handle Redis clients socket reads and writes
# in different I/O threads. Since especially writing is so slow, normally
# Redis users use pipelining in order to speedup the Redis performances per
# core, and spawn multiple instances in order to scale more. Using I/O
# threads it is possible to easily speedup two times Redis without resorting
# to pipelining nor sharding of the instance.
#
# By default threading is disabled, we suggest enabling it only in machines
# that have at least 4 or more cores, leaving at least one spare core.
# Using more than 8 threads is unlikely to help much. We also recommend using
# threaded I/O only if you actually have performance problems, with Redis
# instances being able to use a quite big percentage of CPU time, otherwise
# there is no point in using this feature.
#
# So for instance if you have a four cores boxes, try to use 2 or 3 I/O
# threads, if you have a 8 cores, try to use 6 threads. In order to
# enable I/O threads use the following configuration directive:
#
# io-threads 4
#
# Setting io-threads to 1 will just use the main thread as usually.
# When I/O threads are enabled, we only use threads for writes, that is
# to thread the write(2) syscall and transfer the client buffers to the
# socket. However it is also possible to enable threading of reads and
# protocol parsing using the following configuration directive, by setting
# it to yes:
#
# io-threads-do-reads no
#
# Usually threading reads doesn't help much.
#
# NOTE 1: This configuration directive cannot be changed at runtime via
# CONFIG SET. Aso this feature currently does not work when SSL is
# enabled.
#
# NOTE 2: If you want to test the Redis speedup using redis-benchmark, make
# sure you also run the benchmark itself in threaded mode, using the
# --threads option to match the number of Redis theads, otherwise you'll not
# be able to notice the improvements.
############################## APPEND ONLY MODE ###############################
# By default Redis asynchronously dumps the dataset on disk. This mode is
@@ -1316,7 +1381,11 @@ latency-monitor-threshold 0
# z Sorted set commands
# x Expired events (events generated every time a key expires)
# e Evicted events (events generated when a key is evicted for maxmemory)
# A Alias for g$lshzxe, so that the "AKE" string means all the events.
# t Stream commands
# m Key-miss events (Note: It is not included in the 'A' class)
# A Alias for g$lshzxet, so that the "AKE" string means all the events
# (Except key-miss events which are excluded from 'A' due to their
# unique nature).
#
# The "notify-keyspace-events" takes as argument a string that is composed
# of zero or multiple characters. The empty string means that notifications
@@ -1566,7 +1635,7 @@ hz 10
# offers, and enables by default, the ability to use an adaptive HZ value
# which will temporary raise when there are many connected clients.
#
# When dynamic HZ is enabled, the actual configured HZ will be used as
# When dynamic HZ is enabled, the actual configured HZ will be used
# as a baseline, but multiples of the configured HZ value will be actually
# used as needed once more clients are connected. In this way an idle
# instance will use very little CPU time while a busy instance will be
+20
View File
@@ -102,6 +102,18 @@ sentinel monitor mymaster 127.0.0.1 6379 2
#
# sentinel auth-pass mymaster MySUPER--secret-0123passw0rd
# sentinel auth-user <master-name> <username>
#
# This is useful in order to authenticate to instances having ACL capabilities,
# that is, running Redis 6.0 or greater. When just auth-pass is provided the
# Sentinel instance will authenticate to Redis using the old "AUTH <pass>"
# method. When also an username is provided, it will use "AUTH <user> <pass>".
# In the Redis servers side, the ACL to provide just minimal access to
# Sentinel instances, should be configured along the following lines:
#
# user sentinel-user >somepassword +client +subscribe +publish \
# +ping +info +multi +slaveof +config +client +exec on
# sentinel down-after-milliseconds <master-name> <milliseconds>
#
# Number of milliseconds the master (or any attached replica or sentinel) should
@@ -112,6 +124,14 @@ sentinel monitor mymaster 127.0.0.1 6379 2
# Default is 30 seconds.
sentinel down-after-milliseconds mymaster 30000
# requirepass <password>
#
# You can configure Sentinel itself to require a password, however when doing
# so Sentinel will try to authenticate with the same password to all the
# other Sentinels. So you need to configure all your Sentinels in a given
# group with the same "requirepass" password. Check the following documentation
# for more info: https://redis.io/topics/sentinel
# sentinel parallel-syncs <master-name> <numreplicas>
#
# How many replicas we can reconfigure to point to the new replica simultaneously
+8 -4
View File
@@ -206,11 +206,11 @@ endif
REDIS_SERVER_NAME=redis-server
REDIS_SENTINEL_NAME=redis-sentinel
REDIS_SERVER_OBJ=adlist.o quicklist.o ae.o anet.o dict.o server.o sds.o zmalloc.o lzf_c.o lzf_d.o pqsort.o zipmap.o sha1.o ziplist.o release.o networking.o util.o object.o db.o replication.o rdb.o t_string.o t_list.o t_set.o t_zset.o t_hash.o config.o aof.o pubsub.o multi.o debug.o sort.o intset.o syncio.o cluster.o crc16.o endianconv.o slowlog.o scripting.o bio.o rio.o rand.o memtest.o crc64.o bitops.o sentinel.o notify.o setproctitle.o blocked.o hyperloglog.o latency.o sparkline.o redis-check-rdb.o redis-check-aof.o geo.o lazyfree.o module.o evict.o expire.o geohash.o geohash_helper.o childinfo.o defrag.o siphash.o rax.o t_stream.o listpack.o localtime.o lolwut.o lolwut5.o lolwut6.o acl.o gopher.o tracking.o connection.o tls.o sha256.o
REDIS_SERVER_OBJ=adlist.o quicklist.o ae.o anet.o dict.o server.o sds.o zmalloc.o lzf_c.o lzf_d.o pqsort.o zipmap.o sha1.o ziplist.o release.o networking.o util.o object.o db.o replication.o rdb.o t_string.o t_list.o t_set.o t_zset.o t_hash.o config.o aof.o pubsub.o multi.o debug.o sort.o intset.o syncio.o cluster.o crc16.o endianconv.o slowlog.o scripting.o bio.o rio.o rand.o memtest.o crc64.o bitops.o sentinel.o notify.o setproctitle.o blocked.o hyperloglog.o latency.o sparkline.o redis-check-rdb.o redis-check-aof.o geo.o lazyfree.o module.o evict.o expire.o geohash.o geohash_helper.o childinfo.o defrag.o siphash.o rax.o t_stream.o listpack.o localtime.o lolwut.o lolwut5.o lolwut6.o acl.o gopher.o tracking.o connection.o tls.o sha256.o timeout.o
REDIS_CLI_NAME=redis-cli
REDIS_CLI_OBJ=anet.o adlist.o dict.o redis-cli.o zmalloc.o release.o anet.o ae.o crc64.o siphash.o crc16.o
REDIS_CLI_OBJ=anet.o adlist.o dict.o redis-cli.o zmalloc.o release.o ae.o crc64.o siphash.o crc16.o
REDIS_BENCHMARK_NAME=redis-benchmark
REDIS_BENCHMARK_OBJ=ae.o anet.o redis-benchmark.o adlist.o dict.o zmalloc.o siphash.o redis-benchmark.o
REDIS_BENCHMARK_OBJ=ae.o anet.o redis-benchmark.o adlist.o dict.o zmalloc.o siphash.o
REDIS_CHECK_RDB_NAME=redis-check-rdb
REDIS_CHECK_AOF_NAME=redis-check-aof
@@ -283,14 +283,18 @@ $(REDIS_BENCHMARK_NAME): $(REDIS_BENCHMARK_OBJ)
dict-benchmark: dict.c zmalloc.c sds.c siphash.c
$(REDIS_CC) $(FINAL_CFLAGS) $^ -D DICT_BENCHMARK_MAIN -o $@ $(FINAL_LIBS)
DEP = $(REDIS_SERVER_OBJ:%.o=%.d) $(REDIS_CLI_OBJ:%.o=%.d) $(REDIS_BENCHMARK_OBJ:%.o=%.d)
-include $(DEP)
# Because the jemalloc.h header is generated as a part of the jemalloc build,
# building it should complete before building any other object. Instead of
# depending on a single artifact, build all dependencies first.
%.o: %.c .make-prerequisites
$(REDIS_CC) -c $<
$(REDIS_CC) -MMD -o $@ -c $<
clean:
rm -rf $(REDIS_SERVER_NAME) $(REDIS_SENTINEL_NAME) $(REDIS_CLI_NAME) $(REDIS_BENCHMARK_NAME) $(REDIS_CHECK_RDB_NAME) $(REDIS_CHECK_AOF_NAME) *.o *.gcda *.gcno *.gcov redis.info lcov-html Makefile.dep dict-benchmark
rm -f $(DEP)
.PHONY: clean
+215 -23
View File
@@ -49,6 +49,8 @@ list *UsersToLoad; /* This is a list of users found in the configuration file
array of SDS pointers: the first is the user name,
all the remaining pointers are ACL rules in the same
format as ACLSetUser(). */
list *ACLLog; /* Our security log, the user is able to inspect that
using the ACL LOG command .*/
struct ACLCategoryItem {
const char *name;
@@ -93,6 +95,7 @@ struct ACLUserFlag {
void ACLResetSubcommandsForCommand(user *u, unsigned long id);
void ACLResetSubcommands(user *u);
void ACLAddAllowedSubcommand(user *u, unsigned long id, const char *sub);
void ACLFreeLogEntry(void *le);
/* The length of the string representation of a hashed password. */
#define HASH_PASSWORD_LEN SHA256_BLOCK_SIZE*2
@@ -183,12 +186,12 @@ int ACLListMatchSds(void *a, void *b) {
return sdscmp(a,b) == 0;
}
/* Method to free list elements from ACL users password/ptterns lists. */
/* Method to free list elements from ACL users password/patterns lists. */
void ACLListFreeSds(void *item) {
sdsfree(item);
}
/* Method to duplicate list elements from ACL users password/ptterns lists. */
/* Method to duplicate list elements from ACL users password/patterns lists. */
void *ACLListDupSds(void *item) {
return sdsdup(item);
}
@@ -896,16 +899,6 @@ char *ACLSetUserStringError(void) {
return errmsg;
}
/* Return the first password of the default user or NULL.
* This function is needed for backward compatibility with the old
* directive "requirepass" when Redis supported a single global
* password. */
sds ACLDefaultUserFirstPassword(void) {
if (listLength(DefaultUser->passwords) == 0) return NULL;
listNode *first = listFirst(DefaultUser->passwords);
return listNodeValue(first);
}
/* Initialize the default user, that will always exist for all the process
* lifetime. */
void ACLInitDefaultUser(void) {
@@ -920,7 +913,9 @@ void ACLInitDefaultUser(void) {
void ACLInit(void) {
Users = raxNew();
UsersToLoad = listCreate();
ACLLog = listCreate();
ACLInitDefaultUser();
server.requirepass = NULL; /* Only used for backward compatibility. */
}
/* Check the username and password pair and return C_OK if they are valid,
@@ -978,6 +973,7 @@ int ACLAuthenticateUser(client *c, robj *username, robj *password) {
moduleNotifyUserChanged(c);
return C_OK;
} else {
addACLLogEntry(c,ACL_DENIED_AUTH,0,username->ptr);
return C_ERR;
}
}
@@ -1034,7 +1030,7 @@ user *ACLGetUserByName(const char *name, size_t namelen) {
* command cannot be executed because the user is not allowed to run such
* command, the second if the command is denied because the user is trying
* to access keys that are not among the specified patterns. */
int ACLCheckCommandPerm(client *c) {
int ACLCheckCommandPerm(client *c, int *keyidxptr) {
user *u = c->user;
uint64_t id = c->cmd->id;
@@ -1094,6 +1090,7 @@ int ACLCheckCommandPerm(client *c) {
}
}
if (!match) {
if (keyidxptr) *keyidxptr = keyidx[j];
getKeysFreeResult(keyidx);
return ACL_DENIED_KEY;
}
@@ -1454,6 +1451,131 @@ void ACLLoadUsersAtStartup(void) {
}
}
/* =============================================================================
* ACL log
* ==========================================================================*/
#define ACL_LOG_CTX_TOPLEVEL 0
#define ACL_LOG_CTX_LUA 1
#define ACL_LOG_CTX_MULTI 2
#define ACL_LOG_GROUPING_MAX_TIME_DELTA 60000
/* This structure defines an entry inside the ACL log. */
typedef struct ACLLogEntry {
uint64_t count; /* Number of times this happened recently. */
int reason; /* Reason for denying the command. ACL_DENIED_*. */
int context; /* Toplevel, Lua or MULTI/EXEC? ACL_LOG_CTX_*. */
sds object; /* The key name or command name. */
sds username; /* User the client is authenticated with. */
mstime_t ctime; /* Milliseconds time of last update to this entry. */
sds cinfo; /* Client info (last client if updated). */
} ACLLogEntry;
/* This function will check if ACL entries 'a' and 'b' are similar enough
* that we should actually update the existing entry in our ACL log instead
* of creating a new one. */
int ACLLogMatchEntry(ACLLogEntry *a, ACLLogEntry *b) {
if (a->reason != b->reason) return 0;
if (a->context != b->context) return 0;
mstime_t delta = a->ctime - b->ctime;
if (delta < 0) delta = -delta;
if (delta > ACL_LOG_GROUPING_MAX_TIME_DELTA) return 0;
if (sdscmp(a->object,b->object) != 0) return 0;
if (sdscmp(a->username,b->username) != 0) return 0;
return 1;
}
/* Release an ACL log entry. */
void ACLFreeLogEntry(void *leptr) {
ACLLogEntry *le = leptr;
sdsfree(le->object);
sdsfree(le->username);
sdsfree(le->cinfo);
zfree(le);
}
/* Adds a new entry in the ACL log, making sure to delete the old entry
* if we reach the maximum length allowed for the log. This function attempts
* to find similar entries in the current log in order to bump the counter of
* the log entry instead of creating many entries for very similar ACL
* rules issues.
*
* The keypos argument is only used when the reason is ACL_DENIED_KEY, since
* it allows the function to log the key name that caused the problem.
* Similarly the username is only passed when we failed to authenticate the
* user with AUTH or HELLO, for the ACL_DENIED_AUTH reason. Otherwise
* it will just be NULL.
*/
void addACLLogEntry(client *c, int reason, int keypos, sds username) {
/* Create a new entry. */
struct ACLLogEntry *le = zmalloc(sizeof(*le));
le->count = 1;
le->reason = reason;
le->username = sdsdup(reason == ACL_DENIED_AUTH ? username : c->user->name);
le->ctime = mstime();
switch(reason) {
case ACL_DENIED_CMD: le->object = sdsnew(c->cmd->name); break;
case ACL_DENIED_KEY: le->object = sdsnew(c->argv[keypos]->ptr); break;
case ACL_DENIED_AUTH: le->object = sdsnew(c->argv[0]->ptr); break;
default: le->object = sdsempty();
}
client *realclient = c;
if (realclient->flags & CLIENT_LUA) realclient = server.lua_caller;
le->cinfo = catClientInfoString(sdsempty(),realclient);
if (c->flags & CLIENT_MULTI) {
le->context = ACL_LOG_CTX_MULTI;
} else if (c->flags & CLIENT_LUA) {
le->context = ACL_LOG_CTX_LUA;
} else {
le->context = ACL_LOG_CTX_TOPLEVEL;
}
/* Try to match this entry with past ones, to see if we can just
* update an existing entry instead of creating a new one. */
long toscan = 10; /* Do a limited work trying to find duplicated. */
listIter li;
listNode *ln;
listRewind(ACLLog,&li);
ACLLogEntry *match = NULL;
while (toscan-- && (ln = listNext(&li)) != NULL) {
ACLLogEntry *current = listNodeValue(ln);
if (ACLLogMatchEntry(current,le)) {
match = current;
listDelNode(ACLLog,ln);
listAddNodeHead(ACLLog,current);
break;
}
}
/* If there is a match update the entry, otherwise add it as a
* new one. */
if (match) {
/* We update a few fields of the existing entry and bump the
* counter of events for this entry. */
sdsfree(match->cinfo);
match->cinfo = le->cinfo;
match->ctime = le->ctime;
match->count++;
/* Release the old entry. */
le->cinfo = NULL;
ACLFreeLogEntry(le);
} else {
/* Add it to our list of entires. We'll have to trim the list
* to its maximum size. */
listAddNodeHead(ACLLog, le);
while(listLength(ACLLog) > server.acllog_max_len) {
listNode *ln = listLast(ACLLog);
ACLLogEntry *le = listNodeValue(ln);
ACLFreeLogEntry(le);
listDelNode(ACLLog,ln);
}
}
}
/* =============================================================================
* ACL related commands
* ==========================================================================*/
@@ -1461,6 +1583,7 @@ void ACLLoadUsersAtStartup(void) {
/* ACL -- show and modify the configuration of ACL users.
* ACL HELP
* ACL LOAD
* ACL SAVE
* ACL LIST
* ACL USERS
* ACL CAT [<category>]
@@ -1469,6 +1592,7 @@ void ACLLoadUsersAtStartup(void) {
* ACL GETUSER <username>
* ACL GENPASS
* ACL WHOAMI
* ACL LOG [<count> | RESET]
*/
void aclCommand(client *c) {
char *sub = c->argv[1]->ptr;
@@ -1655,18 +1779,86 @@ void aclCommand(client *c) {
char pass[32]; /* 128 bits of actual pseudo random data. */
getRandomHexChars(pass,sizeof(pass));
addReplyBulkCBuffer(c,pass,sizeof(pass));
} else if (!strcasecmp(sub,"log") && (c->argc == 2 || c->argc ==3)) {
long count = 10; /* Number of entries to emit by default. */
/* Parse the only argument that LOG may have: it could be either
* the number of entires the user wants to display, or alternatively
* the "RESET" command in order to flush the old entires. */
if (c->argc == 3) {
if (!strcasecmp(c->argv[2]->ptr,"reset")) {
listSetFreeMethod(ACLLog,ACLFreeLogEntry);
listEmpty(ACLLog);
listSetFreeMethod(ACLLog,NULL);
addReply(c,shared.ok);
return;
} else if (getLongFromObjectOrReply(c,c->argv[2],&count,NULL)
!= C_OK)
{
return;
}
if (count < 0) count = 0;
}
/* Fix the count according to the number of entries we got. */
if ((size_t)count > listLength(ACLLog))
count = listLength(ACLLog);
addReplyArrayLen(c,count);
listIter li;
listNode *ln;
listRewind(ACLLog,&li);
mstime_t now = mstime();
while (count-- && (ln = listNext(&li)) != NULL) {
ACLLogEntry *le = listNodeValue(ln);
addReplyMapLen(c,7);
addReplyBulkCString(c,"count");
addReplyLongLong(c,le->count);
addReplyBulkCString(c,"reason");
char *reasonstr;
switch(le->reason) {
case ACL_DENIED_CMD: reasonstr="command"; break;
case ACL_DENIED_KEY: reasonstr="key"; break;
case ACL_DENIED_AUTH: reasonstr="auth"; break;
default: reasonstr="unknown";
}
addReplyBulkCString(c,reasonstr);
addReplyBulkCString(c,"context");
char *ctxstr;
switch(le->context) {
case ACL_LOG_CTX_TOPLEVEL: ctxstr="toplevel"; break;
case ACL_LOG_CTX_MULTI: ctxstr="multi"; break;
case ACL_LOG_CTX_LUA: ctxstr="lua"; break;
default: ctxstr="unknown";
}
addReplyBulkCString(c,ctxstr);
addReplyBulkCString(c,"object");
addReplyBulkCBuffer(c,le->object,sdslen(le->object));
addReplyBulkCString(c,"username");
addReplyBulkCBuffer(c,le->username,sdslen(le->username));
addReplyBulkCString(c,"age-seconds");
double age = (double)(now - le->ctime)/1000;
addReplyDouble(c,age);
addReplyBulkCString(c,"client-info");
addReplyBulkCBuffer(c,le->cinfo,sdslen(le->cinfo));
}
} else if (!strcasecmp(sub,"help")) {
const char *help[] = {
"LOAD -- Reload users from the ACL file.",
"LIST -- Show user details in config file format.",
"USERS -- List all the registered usernames.",
"SETUSER <username> [attribs ...] -- Create or modify a user.",
"GETUSER <username> -- Get the user details.",
"DELUSER <username> [...] -- Delete a list of users.",
"CAT -- List available categories.",
"CAT <category> -- List commands inside category.",
"GENPASS -- Generate a secure user password.",
"WHOAMI -- Return the current connection username.",
"LOAD -- Reload users from the ACL file.",
"SAVE -- Save the current config to the ACL file.",
"LIST -- Show user details in config file format.",
"USERS -- List all the registered usernames.",
"SETUSER <username> [attribs ...] -- Create or modify a user.",
"GETUSER <username> -- Get the user details.",
"DELUSER <username> [...] -- Delete a list of users.",
"CAT -- List available categories.",
"CAT <category> -- List commands inside category.",
"GENPASS -- Generate a secure user password.",
"WHOAMI -- Return the current connection username.",
"LOG [<count> | RESET] -- Show the ACL log entries.",
NULL
};
addReplyHelp(c,help);
+14 -2
View File
@@ -135,6 +135,14 @@ void aeDeleteEventLoop(aeEventLoop *eventLoop) {
aeApiFree(eventLoop);
zfree(eventLoop->events);
zfree(eventLoop->fired);
/* Free the time events list. */
aeTimeEvent *next_te, *te = eventLoop->timeEventHead;
while (te) {
next_te = te->next;
zfree(te);
te = next_te;
}
zfree(eventLoop);
}
@@ -456,6 +464,7 @@ int aeProcessEvents(aeEventLoop *eventLoop, int flags)
if (!invert && fe->mask & mask & AE_READABLE) {
fe->rfileProc(eventLoop,fd,fe->clientData,mask);
fired++;
fe = &eventLoop->events[fd]; /* Refresh in case of resize. */
}
/* Fire the writable event. */
@@ -468,8 +477,11 @@ int aeProcessEvents(aeEventLoop *eventLoop, int flags)
/* If we have to invert the call, fire the readable event now
* after the writable one. */
if (invert && fe->mask & mask & AE_READABLE) {
if (!fired || fe->wfileProc != fe->rfileProc) {
if (invert) {
fe = &eventLoop->events[fd]; /* Refresh in case of resize. */
if ((fe->mask & mask & AE_READABLE) &&
(!fired || fe->wfileProc != fe->rfileProc))
{
fe->rfileProc(eventLoop,fd,fe->clientData,mask);
fired++;
}
+24 -11
View File
@@ -242,6 +242,7 @@ void stopAppendOnly(void) {
server.aof_fd = -1;
server.aof_selected_db = -1;
server.aof_state = AOF_OFF;
server.aof_rewrite_scheduled = 0;
killAppendOnlyChild();
}
@@ -781,18 +782,26 @@ int loadAppendOnlyFile(char *filename) {
argc = atoi(buf+1);
if (argc < 1) goto fmterr;
/* Load the next command in the AOF as our fake client
* argv. */
argv = zmalloc(sizeof(robj*)*argc);
fakeClient->argc = argc;
fakeClient->argv = argv;
for (j = 0; j < argc; j++) {
if (fgets(buf,sizeof(buf),fp) == NULL) {
/* Parse the argument len. */
char *readres = fgets(buf,sizeof(buf),fp);
if (readres == NULL || buf[0] != '$') {
fakeClient->argc = j; /* Free up to j-1. */
freeFakeClientArgv(fakeClient);
goto readerr;
if (readres == NULL)
goto readerr;
else
goto fmterr;
}
if (buf[0] != '$') goto fmterr;
len = strtol(buf+1,NULL,10);
/* Read it into a string object. */
argsds = sdsnewlen(SDS_NOINIT,len);
if (len && fread(argsds,len,1,fp) == 0) {
sdsfree(argsds);
@@ -801,10 +810,12 @@ int loadAppendOnlyFile(char *filename) {
goto readerr;
}
argv[j] = createObject(OBJ_STRING,argsds);
/* Discard CRLF. */
if (fread(buf,2,1,fp) == 0) {
fakeClient->argc = j+1; /* Free up to j. */
freeFakeClientArgv(fakeClient);
goto readerr; /* discard CRLF */
goto readerr;
}
}
@@ -820,7 +831,7 @@ int loadAppendOnlyFile(char *filename) {
if (cmd == server.multiCommand) valid_before_multi = valid_up_to;
/* Run the command in the context of a fake client */
fakeClient->cmd = cmd;
fakeClient->cmd = fakeClient->lastcmd = cmd;
if (fakeClient->flags & CLIENT_MULTI &&
fakeClient->cmd->proc != execCommand)
{
@@ -1139,7 +1150,7 @@ int rioWriteBulkStreamID(rio *r,streamID *id) {
int retval;
sds replyid = sdscatfmt(sdsempty(),"%U-%U",id->ms,id->seq);
if ((retval = rioWriteBulkString(r,replyid,sdslen(replyid))) == 0) return 0;
retval = rioWriteBulkString(r,replyid,sdslen(replyid));
sdsfree(replyid);
return retval;
}
@@ -1201,12 +1212,13 @@ int rewriteStreamObject(rio *r, robj *key, robj *o) {
/* Use the XADD MAXLEN 0 trick to generate an empty stream if
* the key we are serializing is an empty string, which is possible
* for the Stream type. */
id.ms = 0; id.seq = 1;
if (rioWriteBulkCount(r,'*',7) == 0) return 0;
if (rioWriteBulkString(r,"XADD",4) == 0) return 0;
if (rioWriteBulkObject(r,key) == 0) return 0;
if (rioWriteBulkString(r,"MAXLEN",6) == 0) return 0;
if (rioWriteBulkString(r,"0",1) == 0) return 0;
if (rioWriteBulkStreamID(r,&s->last_id) == 0) return 0;
if (rioWriteBulkStreamID(r,&id) == 0) return 0;
if (rioWriteBulkString(r,"x",1) == 0) return 0;
if (rioWriteBulkString(r,"y",1) == 0) return 0;
}
@@ -1787,14 +1799,15 @@ void backgroundRewriteDoneHandler(int exitcode, int bysignal) {
serverLog(LL_VERBOSE,
"Background AOF rewrite signal handler took %lldus", ustime()-now);
} else if (!bysignal && exitcode != 0) {
server.aof_lastbgrewrite_status = C_ERR;
serverLog(LL_WARNING,
"Background AOF rewrite terminated with error");
} else {
/* SIGUSR1 is whitelisted, so we have a way to kill a child without
* tirggering an error condition. */
if (bysignal != SIGUSR1)
server.aof_lastbgrewrite_status = C_ERR;
serverLog(LL_WARNING,
"Background AOF rewrite terminated with error");
} else {
server.aof_lastbgrewrite_status = C_ERR;
serverLog(LL_WARNING,
"Background AOF rewrite terminated by signal %d", bysignal);
+1 -1
View File
@@ -27,7 +27,7 @@
* POSSIBILITY OF SUCH DAMAGE.
*/
char *ascii_logo =
const char *ascii_logo =
" _._ \n"
" _.-``__ ''-._ \n"
" _.-`` `. `_. ''-._ Redis %s (%s/%d) %s bit\n"
+21 -1
View File
@@ -902,6 +902,9 @@ void bitposCommand(client *c) {
* OVERFLOW [WRAP|SAT|FAIL]
*/
#define BITFIELD_FLAG_NONE 0
#define BITFIELD_FLAG_READONLY (1<<0)
struct bitfieldOp {
uint64_t offset; /* Bitfield offset. */
int64_t i64; /* Increment amount (INCRBY) or SET value */
@@ -911,7 +914,10 @@ struct bitfieldOp {
int sign; /* True if signed, otherwise unsigned op. */
};
void bitfieldCommand(client *c) {
/* This implements both the BITFIELD command and the BITFIELD_RO command
* when flags is set to BITFIELD_FLAG_READONLY: in this case only the
* GET subcommand is allowed, other subcommands will return an error. */
void bitfieldGeneric(client *c, int flags) {
robj *o;
size_t bitoffset;
int j, numops = 0, changes = 0;
@@ -999,6 +1005,12 @@ void bitfieldCommand(client *c) {
return;
}
} else {
if (flags & BITFIELD_FLAG_READONLY) {
zfree(ops);
addReplyError(c, "BITFIELD_RO only supports the GET subcommand");
return;
}
/* Lookup by making room up to the farest bit reached by
* this operation. */
if ((o = lookupStringForBitCommand(c,
@@ -1129,3 +1141,11 @@ void bitfieldCommand(client *c) {
}
zfree(ops);
}
void bitfieldCommand(client *c) {
bitfieldGeneric(c, BITFIELD_FLAG_NONE);
}
void bitfieldroCommand(client *c) {
bitfieldGeneric(c, BITFIELD_FLAG_READONLY);
}
+3 -40
View File
@@ -31,9 +31,6 @@
*
* API:
*
* getTimeoutFromObjectOrReply() is just an utility function to parse a
* timeout argument since blocking operations usually require a timeout.
*
* blockClient() set the CLIENT_BLOCKED flag in the client, and set the
* specified block type 'btype' filed to one of BLOCKED_* macros.
*
@@ -67,42 +64,6 @@
int serveClientBlockedOnList(client *receiver, robj *key, robj *dstkey, redisDb *db, robj *value, int where);
/* Get a timeout value from an object and store it into 'timeout'.
* The final timeout is always stored as milliseconds as a time where the
* timeout will expire, however the parsing is performed according to
* the 'unit' that can be seconds or milliseconds.
*
* Note that if the timeout is zero (usually from the point of view of
* commands API this means no timeout) the value stored into 'timeout'
* is zero. */
int getTimeoutFromObjectOrReply(client *c, robj *object, mstime_t *timeout, int unit) {
long long tval;
long double ftval;
if (unit == UNIT_SECONDS) {
if (getLongDoubleFromObjectOrReply(c,object,&ftval,
"timeout is not an float or out of range") != C_OK)
return C_ERR;
tval = (long long) (ftval * 1000.0);
} else {
if (getLongLongFromObjectOrReply(c,object,&tval,
"timeout is not an integer or out of range") != C_OK)
return C_ERR;
}
if (tval < 0) {
addReplyError(c,"timeout is negative");
return C_ERR;
}
if (tval > 0) {
tval += mstime();
}
*timeout = tval;
return C_OK;
}
/* Block a client for the specific operation type. Once the CLIENT_BLOCKED
* flag is set client query buffer is not longer processed, but accumulated,
* and will be processed when the client is unblocked. */
@@ -111,6 +72,7 @@ void blockClient(client *c, int btype) {
c->btype = btype;
server.blocked_clients++;
server.blocked_clients_by_type[btype]++;
addClientToTimeoutTable(c);
}
/* This function is called in the beforeSleep() function of the event loop
@@ -185,6 +147,7 @@ void unblockClient(client *c) {
server.blocked_clients_by_type[c->btype]--;
c->flags &= ~CLIENT_BLOCKED;
c->btype = BLOCKED_NONE;
removeClientFromTimeoutTable(c);
queueClientForReprocessing(c);
}
@@ -388,7 +351,7 @@ void serveClientsBlockedOnStreamKey(robj *o, readyList *rl) {
if (streamCompareID(&s->last_id, gt) > 0) {
streamID start = *gt;
start.seq++; /* Can't overflow, it's an uint64_t */
streamIncrID(&start);
/* Lookup the consumer for the group, if any. */
streamConsumer *consumer = NULL;
+29 -12
View File
@@ -157,7 +157,10 @@ int clusterLoadConfig(char *filename) {
}
/* Regular config lines have at least eight fields */
if (argc < 8) goto fmterr;
if (argc < 8) {
sdsfreesplitres(argv,argc);
goto fmterr;
}
/* Create this node if it does not exist */
n = clusterLookupNode(argv[0]);
@@ -166,7 +169,10 @@ int clusterLoadConfig(char *filename) {
clusterAddNode(n);
}
/* Address and port */
if ((p = strrchr(argv[1],':')) == NULL) goto fmterr;
if ((p = strrchr(argv[1],':')) == NULL) {
sdsfreesplitres(argv,argc);
goto fmterr;
}
*p = '\0';
memcpy(n->ip,argv[1],strlen(argv[1])+1);
char *port = p+1;
@@ -247,7 +253,10 @@ int clusterLoadConfig(char *filename) {
*p = '\0';
direction = p[1]; /* Either '>' or '<' */
slot = atoi(argv[j]+1);
if (slot < 0 || slot >= CLUSTER_SLOTS) goto fmterr;
if (slot < 0 || slot >= CLUSTER_SLOTS) {
sdsfreesplitres(argv,argc);
goto fmterr;
}
p += 3;
cn = clusterLookupNode(p);
if (!cn) {
@@ -267,8 +276,12 @@ int clusterLoadConfig(char *filename) {
} else {
start = stop = atoi(argv[j]);
}
if (start < 0 || start >= CLUSTER_SLOTS) goto fmterr;
if (stop < 0 || stop >= CLUSTER_SLOTS) goto fmterr;
if (start < 0 || start >= CLUSTER_SLOTS ||
stop < 0 || stop >= CLUSTER_SLOTS)
{
sdsfreesplitres(argv,argc);
goto fmterr;
}
while(start <= stop) clusterAddSlot(n, start++);
}
@@ -668,9 +681,10 @@ void clusterAcceptHandler(aeEventLoop *el, int fd, void *privdata, int mask) {
* or schedule it for later depending on connection implementation.
*/
if (connAccept(conn, clusterConnAcceptHandler) == C_ERR) {
serverLog(LL_VERBOSE,
"Error accepting cluster node connection: %s",
connGetLastError(conn));
if (connGetState(conn) == CONN_STATE_ERROR)
serverLog(LL_VERBOSE,
"Error accepting cluster node connection: %s",
connGetLastError(conn));
connClose(conn);
return;
}
@@ -919,7 +933,7 @@ int clusterAddNode(clusterNode *node) {
return (retval == DICT_OK) ? C_OK : C_ERR;
}
/* Remove a node from the cluster. The functio performs the high level
/* Remove a node from the cluster. The function performs the high level
* cleanup, calling freeClusterNode() for the low level cleanup.
* Here we do the following:
*
@@ -4248,7 +4262,7 @@ void clusterCommand(client *c) {
"FORGET <node-id> -- Remove a node from the cluster.",
"GETKEYSINSLOT <slot> <count> -- Return key names stored by current node in a slot.",
"FLUSHSLOTS -- Delete current node own slots information.",
"INFO - Return onformation about the cluster.",
"INFO - Return information about the cluster.",
"KEYSLOT <key> -- Return the hash slot for <key>.",
"MEET <ip> <port> [bus-port] -- Connect nodes into a working cluster.",
"MYID -- Return the node id.",
@@ -4259,6 +4273,7 @@ void clusterCommand(client *c) {
"SET-config-epoch <epoch> - Set config epoch of current node.",
"SETSLOT <slot> (importing|migrating|stable|node <node-id>) -- Set slot state.",
"REPLICAS <node-id> -- Return <node-id> replicas.",
"SAVECONFIG - Force saving cluster configuration on disk.",
"SLOTS -- Return information about slots range mappings. Each range is made of:",
" start, end, master and replicas IP addresses, ports and ids",
NULL
@@ -4951,7 +4966,7 @@ void restoreCommand(client *c) {
rioInitWithBuffer(&payload,c->argv[3]->ptr);
if (((type = rdbLoadObjectType(&payload)) == -1) ||
((obj = rdbLoadObject(type,&payload,c->argv[1])) == NULL))
((obj = rdbLoadObject(type,&payload,c->argv[1]->ptr)) == NULL))
{
addReplyError(c,"Bad data format");
return;
@@ -4968,6 +4983,7 @@ void restoreCommand(client *c) {
}
objectSetLRUOrLFU(obj,lfu_freq,lru_idle,lru_clock,1000);
signalModifiedKey(c->db,c->argv[1]);
notifyKeyspaceEvent(NOTIFY_GENERIC,"restore",c->argv[1],c->db->id);
addReply(c,shared.ok);
server.dirty++;
}
@@ -5314,6 +5330,7 @@ try_again:
/* No COPY option: remove the local key, signal the change. */
dbDelete(c->db,kv[j]);
signalModifiedKey(c->db,kv[j]);
notifyKeyspaceEvent(NOTIFY_GENERIC,"del",kv[j],c->db->id);
server.dirty++;
/* Populate the argument vector to replace the old one. */
@@ -5476,7 +5493,7 @@ void readwriteCommand(client *c) {
* already "down" but it is fragile to rely on the update of the global state,
* so we also handle it here.
*
* CLUSTER_REDIR_DOWN_STATE and CLUSTER_REDIR_DOWN_RO_STATE if the cluster is
* CLUSTER_REDIR_DOWN_STATE and CLUSTER_REDIR_DOWN_RO_STATE if the cluster is
* down but the user attempts to execute a command that addresses one or more keys. */
clusterNode *getNodeByQuery(client *c, struct redisCommand *cmd, robj **argv, int argc, int *hashslot, int *error_code) {
clusterNode *n = NULL;
+74 -120
View File
@@ -108,12 +108,12 @@ clientBufferLimitsConfig clientBufferLimitsDefaults[CLIENT_TYPE_OBUF_COUNT] = {
/* Generic config infrastructure function pointers
* int is_valid_fn(val, err)
* Return 1 when val is valid, and 0 when invalid.
* Optionslly set err to a static error string.
* Optionally set err to a static error string.
* int update_fn(val, prev, err)
* This function is called only for CONFIG SET command (not at config file parsing)
* It is called after the actual config is applied,
* Return 1 for success, and 0 for failure.
* Optionslly set err to a static error string.
* Optionally set err to a static error string.
* On failure the config change will be reverted.
*/
@@ -190,8 +190,9 @@ typedef struct typeInterface {
void (*init)(typeData data);
/* Called on server start, should return 1 on success, 0 on error and should set err */
int (*load)(typeData data, sds *argc, int argv, char **err);
/* Called on CONFIG SET, returns 1 on success, 0 on error */
int (*set)(typeData data, sds value, char **err);
/* Called on server startup and CONFIG SET, returns 1 on success, 0 on error
* and can set a verbose err string, update is true when called from CONFIG SET */
int (*set)(typeData data, sds value, int update, char **err);
/* Called on CONFIG GET, required to add output to the client */
void (*get)(client *c, typeData data);
/* Called on CONFIG REWRITE, required to rewrite the config state */
@@ -323,7 +324,11 @@ void loadServerConfigFromString(char *config) {
if ((!strcasecmp(argv[0],config->name) ||
(config->alias && !strcasecmp(argv[0],config->alias))))
{
if (!config->interface.load(config->data, argv, argc, &err)) {
if (argc != 2) {
err = "wrong number of arguments";
goto loaderr;
}
if (!config->interface.set(config->data, argv[1], 0, &err)) {
goto loaderr;
}
@@ -344,6 +349,10 @@ void loadServerConfigFromString(char *config) {
if (addresses > CONFIG_BINDADDR_MAX) {
err = "Too many bind addresses specified"; goto loaderr;
}
/* Free old bind addresses */
for (j = 0; j < server.bindaddr_count; j++) {
zfree(server.bindaddr[j]);
}
for (j = 0; j < addresses; j++)
server.bindaddr[j] = zstrdup(argv[j+1]);
server.bindaddr_count = addresses;
@@ -402,11 +411,15 @@ void loadServerConfigFromString(char *config) {
goto loaderr;
}
/* The old "requirepass" directive just translates to setting
* a password to the default user. */
* a password to the default user. The only thing we do
* additionally is to remember the cleartext password in this
* case, for backward compatibility with Redis <= 5. */
ACLSetUser(DefaultUser,"resetpass",-1);
sds aclop = sdscatprintf(sdsempty(),">%s",argv[1]);
ACLSetUser(DefaultUser,aclop,sdslen(aclop));
sdsfree(aclop);
sdsfree(server.requirepass);
server.requirepass = sdsnew(argv[1]);
} else if (!strcasecmp(argv[0],"list-max-ziplist-entries") && argc == 2){
/* DEAD OPTION */
} else if (!strcasecmp(argv[0],"list-max-ziplist-value") && argc == 2) {
@@ -509,7 +522,8 @@ void loadServerConfigFromString(char *config) {
return;
loaderr:
fprintf(stderr, "\n*** FATAL CONFIG FILE ERROR ***\n");
fprintf(stderr, "\n*** FATAL CONFIG FILE ERROR (Redis %s) ***\n",
REDIS_VERSION);
fprintf(stderr, "Reading the configuration file, at line %d\n", linenum);
fprintf(stderr, ">>> '%s'\n", lines[i]);
fprintf(stderr, "%s\n", err);
@@ -599,7 +613,7 @@ void configSetCommand(client *c) {
if(config->modifiable && (!strcasecmp(c->argv[2]->ptr,config->name) ||
(config->alias && !strcasecmp(c->argv[2]->ptr,config->alias))))
{
if (!config->interface.set(config->data,o->ptr, &errstr)) {
if (!config->interface.set(config->data,o->ptr,1,&errstr)) {
goto badfmt;
}
addReply(c,shared.ok);
@@ -613,11 +627,15 @@ void configSetCommand(client *c) {
config_set_special_field("requirepass") {
if (sdslen(o->ptr) > CONFIG_AUTHPASS_MAX_LEN) goto badfmt;
/* The old "requirepass" directive just translates to setting
* a password to the default user. */
* a password to the default user. The only thing we do
* additionally is to remember the cleartext password in this
* case, for backward compatibility with Redis <= 5. */
ACLSetUser(DefaultUser,"resetpass",-1);
sds aclop = sdscatprintf(sdsempty(),">%s",(char*)o->ptr);
ACLSetUser(DefaultUser,aclop,sdslen(aclop));
sdsfree(aclop);
sdsfree(server.requirepass);
server.requirepass = sdsnew(o->ptr);
} config_set_special_field("save") {
int vlen, j;
sds *v = sdssplitlen(o->ptr,sdslen(o->ptr)," ",1,&vlen);
@@ -720,7 +738,7 @@ void configSetCommand(client *c) {
* config_set_memory_field(name,var) */
} config_set_memory_field(
"client-query-buffer-limit",server.client_max_querybuf_len) {
/* Everyhing else is an error... */
/* Everything else is an error... */
} config_set_else {
addReplyErrorFormat(c,"Unsupported CONFIG parameter: %s",
(char*)c->argv[2]->ptr);
@@ -889,7 +907,7 @@ void configGetCommand(client *c) {
}
if (stringmatch(pattern,"requirepass",1)) {
addReplyBulkCString(c,"requirepass");
sds password = ACLDefaultUserFirstPassword();
sds password = server.requirepass;
if (password) {
addReplyBulkCBuffer(c,password,sdslen(password));
} else {
@@ -1331,7 +1349,7 @@ void rewriteConfigBindOption(struct rewriteConfigState *state) {
void rewriteConfigRequirepassOption(struct rewriteConfigState *state, char *option) {
int force = 1;
sds line;
sds password = ACLDefaultUserFirstPassword();
sds password = server.requirepass;
/* If there is no password set, we don't want the requirepass option
* to be present in the configuration at all. */
@@ -1536,9 +1554,8 @@ static char loadbuf[LOADBUF_SIZE];
.alias = (config_alias), \
.modifiable = (is_modifiable),
#define embedConfigInterface(initfn, loadfn, setfn, getfn, rewritefn) .interface = { \
#define embedConfigInterface(initfn, setfn, getfn, rewritefn) .interface = { \
.init = (initfn), \
.load = (loadfn), \
.set = (setfn), \
.get = (getfn), \
.rewrite = (rewritefn) \
@@ -1561,30 +1578,17 @@ static void boolConfigInit(typeData data) {
*data.yesno.config = data.yesno.default_value;
}
static int boolConfigLoad(typeData data, sds *argv, int argc, char **err) {
int yn;
if (argc != 2) {
*err = "wrong number of arguments";
return 0;
}
if ((yn = yesnotoi(argv[1])) == -1) {
static int boolConfigSet(typeData data, sds value, int update, char **err) {
int yn = yesnotoi(value);
if (yn == -1) {
*err = "argument must be 'yes' or 'no'";
return 0;
}
if (data.yesno.is_valid_fn && !data.yesno.is_valid_fn(yn, err))
return 0;
*data.yesno.config = yn;
return 1;
}
static int boolConfigSet(typeData data, sds value, char **err) {
int yn = yesnotoi(value);
if (yn == -1) return 0;
if (data.yesno.is_valid_fn && !data.yesno.is_valid_fn(yn, err))
return 0;
int prev = *(data.yesno.config);
*(data.yesno.config) = yn;
if (data.yesno.update_fn && !data.yesno.update_fn(yn, prev, err)) {
if (update && data.yesno.update_fn && !data.yesno.update_fn(yn, prev, err)) {
*(data.yesno.config) = prev;
return 0;
}
@@ -1601,7 +1605,7 @@ static void boolConfigRewrite(typeData data, const char *name, struct rewriteCon
#define createBoolConfig(name, alias, modifiable, config_addr, default, is_valid, update) { \
embedCommonConfig(name, alias, modifiable) \
embedConfigInterface(boolConfigInit, boolConfigLoad, boolConfigSet, boolConfigGet, boolConfigRewrite) \
embedConfigInterface(boolConfigInit, boolConfigSet, boolConfigGet, boolConfigRewrite) \
.data.yesno = { \
.config = &(config_addr), \
.default_value = (default), \
@@ -1619,23 +1623,7 @@ static void stringConfigInit(typeData data) {
}
}
static int stringConfigLoad(typeData data, sds *argv, int argc, char **err) {
if (argc != 2) {
*err = "wrong number of arguments";
return 0;
}
if (data.string.is_valid_fn && !data.string.is_valid_fn(argv[1], err))
return 0;
zfree(*data.string.config);
if (data.string.convert_empty_to_null) {
*data.string.config = argv[1][0] ? zstrdup(argv[1]) : NULL;
} else {
*data.string.config = zstrdup(argv[1]);
}
return 1;
}
static int stringConfigSet(typeData data, sds value, char **err) {
static int stringConfigSet(typeData data, sds value, int update, char **err) {
if (data.string.is_valid_fn && !data.string.is_valid_fn(value, err))
return 0;
char *prev = *data.string.config;
@@ -1644,7 +1632,7 @@ static int stringConfigSet(typeData data, sds value, char **err) {
} else {
*data.string.config = zstrdup(value);
}
if (data.string.update_fn && !data.string.update_fn(*data.string.config, prev, err)) {
if (update && data.string.update_fn && !data.string.update_fn(*data.string.config, prev, err)) {
zfree(*data.string.config);
*data.string.config = prev;
return 0;
@@ -1666,7 +1654,7 @@ static void stringConfigRewrite(typeData data, const char *name, struct rewriteC
#define createStringConfig(name, alias, modifiable, empty_to_null, config_addr, default, is_valid, update) { \
embedCommonConfig(name, alias, modifiable) \
embedConfigInterface(stringConfigInit, stringConfigLoad, stringConfigSet, stringConfigGet, stringConfigRewrite) \
embedConfigInterface(stringConfigInit, stringConfigSet, stringConfigGet, stringConfigRewrite) \
.data.string = { \
.config = &(config_addr), \
.default_value = (default), \
@@ -1677,67 +1665,52 @@ static void stringConfigRewrite(typeData data, const char *name, struct rewriteC
}
/* Enum configs */
static void configEnumInit(typeData data) {
static void enumConfigInit(typeData data) {
*data.enumd.config = data.enumd.default_value;
}
static int configEnumLoad(typeData data, sds *argv, int argc, char **err) {
if (argc != 2) {
*err = "wrong number of arguments";
return 0;
}
int enumval = configEnumGetValue(data.enumd.enum_value, argv[1]);
static int enumConfigSet(typeData data, sds value, int update, char **err) {
int enumval = configEnumGetValue(data.enumd.enum_value, value);
if (enumval == INT_MIN) {
sds enumerr = sdsnew("argument must be one of the following: ");
configEnum *enumNode = data.enumd.enum_value;
while(enumNode->name != NULL) {
enumerr = sdscatlen(enumerr, enumNode->name, strlen(enumNode->name));
enumerr = sdscatlen(enumerr, enumNode->name,
strlen(enumNode->name));
enumerr = sdscatlen(enumerr, ", ", 2);
enumNode++;
}
sdsrange(enumerr,0,-3); /* Remove final ", ". */
enumerr[sdslen(enumerr) - 2] = '\0';
/* Make sure we don't overrun the fixed buffer */
enumerr[LOADBUF_SIZE - 1] = '\0';
strncpy(loadbuf, enumerr, LOADBUF_SIZE);
loadbuf[LOADBUF_SIZE - 1] = '\0';
sdsfree(enumerr);
*err = loadbuf;
return 0;
}
if (data.enumd.is_valid_fn && !data.enumd.is_valid_fn(enumval, err))
return 0;
*(data.enumd.config) = enumval;
return 1;
}
static int configEnumSet(typeData data, sds value, char **err) {
int enumval = configEnumGetValue(data.enumd.enum_value, value);
if (enumval == INT_MIN) return 0;
if (data.enumd.is_valid_fn && !data.enumd.is_valid_fn(enumval, err))
return 0;
int prev = *(data.enumd.config);
*(data.enumd.config) = enumval;
if (data.enumd.update_fn && !data.enumd.update_fn(enumval, prev, err)) {
if (update && data.enumd.update_fn && !data.enumd.update_fn(enumval, prev, err)) {
*(data.enumd.config) = prev;
return 0;
}
return 1;
}
static void configEnumGet(client *c, typeData data) {
static void enumConfigGet(client *c, typeData data) {
addReplyBulkCString(c, configEnumGetNameOrUnknown(data.enumd.enum_value,*data.enumd.config));
}
static void configEnumRewrite(typeData data, const char *name, struct rewriteConfigState *state) {
static void enumConfigRewrite(typeData data, const char *name, struct rewriteConfigState *state) {
rewriteConfigEnumOption(state, name,*(data.enumd.config), data.enumd.enum_value, data.enumd.default_value);
}
#define createEnumConfig(name, alias, modifiable, enum, config_addr, default, is_valid, update) { \
embedCommonConfig(name, alias, modifiable) \
embedConfigInterface(configEnumInit, configEnumLoad, configEnumSet, configEnumGet, configEnumRewrite) \
embedConfigInterface(enumConfigInit, enumConfigSet, enumConfigGet, enumConfigRewrite) \
.data.enumd = { \
.config = &(config_addr), \
.default_value = (default), \
@@ -1832,49 +1805,22 @@ static int numericBoundaryCheck(typeData data, long long ll, char **err) {
return 1;
}
static int numericConfigLoad(typeData data, sds *argv, int argc, char **err) {
long long ll;
if (argc != 2) {
*err = "wrong number of arguments";
return 0;
}
static int numericConfigSet(typeData data, sds value, int update, char **err) {
long long ll, prev = 0;
if (data.numeric.is_memory) {
int memerr;
ll = memtoll(argv[1], &memerr);
ll = memtoll(value, &memerr);
if (memerr || ll < 0) {
*err = "argument must be a memory value";
return 0;
}
} else {
if (!string2ll(argv[1], sdslen(argv[1]),&ll)) {
if (!string2ll(value, sdslen(value),&ll)) {
*err = "argument couldn't be parsed into an integer" ;
return 0;
}
}
if (!numericBoundaryCheck(data, ll, err))
return 0;
if (data.numeric.is_valid_fn && !data.numeric.is_valid_fn(ll, err))
return 0;
SET_NUMERIC_TYPE(ll)
return 1;
}
static int numericConfigSet(typeData data, sds value, char **err) {
long long ll, prev = 0;
if (data.numeric.is_memory) {
int memerr;
ll = memtoll(value, &memerr);
if (memerr || ll < 0) return 0;
} else {
if (!string2ll(value, sdslen(value),&ll)) return 0;
}
if (!numericBoundaryCheck(data, ll, err))
return 0;
@@ -1884,7 +1830,7 @@ static int numericConfigSet(typeData data, sds value, char **err) {
GET_NUMERIC_TYPE(prev)
SET_NUMERIC_TYPE(ll)
if (data.numeric.update_fn && !data.numeric.update_fn(ll, prev, err)) {
if (update && data.numeric.update_fn && !data.numeric.update_fn(ll, prev, err)) {
SET_NUMERIC_TYPE(prev)
return 0;
}
@@ -1918,7 +1864,7 @@ static void numericConfigRewrite(typeData data, const char *name, struct rewrite
#define embedCommonNumericalConfig(name, alias, modifiable, lower, upper, config_addr, default, memory, is_valid, update) { \
embedCommonConfig(name, alias, modifiable) \
embedConfigInterface(numericConfigInit, numericConfigLoad, numericConfigSet, numericConfigGet, numericConfigRewrite) \
embedConfigInterface(numericConfigInit, numericConfigSet, numericConfigGet, numericConfigRewrite) \
.data.numeric = { \
.lower_bound = (lower), \
.upper_bound = (upper), \
@@ -2061,8 +2007,9 @@ static int updateMaxmemory(long long val, long long prev, char **err) {
UNUSED(prev);
UNUSED(err);
if (val) {
if ((unsigned long long)val < zmalloc_used_memory()) {
serverLog(LL_WARNING,"WARNING: the new maxmemory value set via CONFIG SET is smaller than the current memory usage. This will result in key eviction and/or the inability to accept new write commands depending on the maxmemory-policy.");
size_t used = zmalloc_used_memory()-freeMemoryGetNotCountedMemory();
if ((unsigned long long)val < used) {
serverLog(LL_WARNING,"WARNING: the new maxmemory value set via CONFIG SET (%llu) is smaller than the current memory usage (%zu). This will result in key eviction and/or the inability to accept new write commands depending on the maxmemory-policy.", server.maxmemory, used);
}
freeMemoryIfNeededAndSafe();
}
@@ -2098,6 +2045,10 @@ static int updateMaxclients(long long val, long long prev, char **err) {
static char msg[128];
sprintf(msg, "The operating system is not able to handle the specified number of clients, try with %d", server.maxclients);
*err = msg;
if (server.maxclients > prev) {
server.maxclients = prev;
adjustOpenFilesLimit();
}
return 0;
}
if ((unsigned int) aeGetSetSize(server.el) <
@@ -2137,16 +2088,18 @@ standardConfig configs[] = {
createBoolConfig("rdbchecksum", NULL, IMMUTABLE_CONFIG, server.rdb_checksum, 1, NULL, NULL),
createBoolConfig("daemonize", NULL, IMMUTABLE_CONFIG, server.daemonize, 0, NULL, NULL),
createBoolConfig("io-threads-do-reads", NULL, IMMUTABLE_CONFIG, server.io_threads_do_reads, 0,NULL, NULL), /* Read + parse from threads? */
createBoolConfig("lua-replicate-commands", NULL, IMMUTABLE_CONFIG, server.lua_always_replicate_commands, 1, NULL, NULL),
createBoolConfig("lua-replicate-commands", NULL, MODIFIABLE_CONFIG, server.lua_always_replicate_commands, 1, NULL, NULL),
createBoolConfig("always-show-logo", NULL, IMMUTABLE_CONFIG, server.always_show_logo, 0, NULL, NULL),
createBoolConfig("protected-mode", NULL, MODIFIABLE_CONFIG, server.protected_mode, 1, NULL, NULL),
createBoolConfig("rdbcompression", NULL, MODIFIABLE_CONFIG, server.rdb_compression, 1, NULL, NULL),
createBoolConfig("rdb-del-sync-files", NULL, MODIFIABLE_CONFIG, server.rdb_del_sync_files, 0, NULL, NULL),
createBoolConfig("activerehashing", NULL, MODIFIABLE_CONFIG, server.activerehashing, 1, NULL, NULL),
createBoolConfig("stop-writes-on-bgsave-error", NULL, MODIFIABLE_CONFIG, server.stop_writes_on_bgsave_err, 1, NULL, NULL),
createBoolConfig("dynamic-hz", NULL, MODIFIABLE_CONFIG, server.dynamic_hz, 1, NULL, NULL), /* Adapt hz to # of clients.*/
createBoolConfig("lazyfree-lazy-eviction", NULL, MODIFIABLE_CONFIG, server.lazyfree_lazy_eviction, 0, NULL, NULL),
createBoolConfig("lazyfree-lazy-expire", NULL, MODIFIABLE_CONFIG, server.lazyfree_lazy_expire, 0, NULL, NULL),
createBoolConfig("lazyfree-lazy-server-del", NULL, MODIFIABLE_CONFIG, server.lazyfree_lazy_server_del, 0, NULL, NULL),
createBoolConfig("lazyfree-lazy-user-del", NULL, MODIFIABLE_CONFIG, server.lazyfree_lazy_user_del , 0, NULL, NULL),
createBoolConfig("repl-disable-tcp-nodelay", NULL, MODIFIABLE_CONFIG, server.repl_disable_tcp_nodelay, 0, NULL, NULL),
createBoolConfig("repl-diskless-sync", NULL, MODIFIABLE_CONFIG, server.repl_diskless_sync, 0, NULL, NULL),
createBoolConfig("gopher-enabled", NULL, MODIFIABLE_CONFIG, server.gopher_enabled, 0, NULL, NULL),
@@ -2192,7 +2145,7 @@ standardConfig configs[] = {
/* Integer configs */
createIntConfig("databases", NULL, IMMUTABLE_CONFIG, 1, INT_MAX, server.dbnum, 16, INTEGER_CONFIG, NULL, NULL),
createIntConfig("port", NULL, IMMUTABLE_CONFIG, 0, 65535, server.port, 6379, INTEGER_CONFIG, NULL, NULL), /* TCP port. */
createIntConfig("io-threads", NULL, IMMUTABLE_CONFIG, 1, 512, server.io_threads_num, 1, INTEGER_CONFIG, NULL, NULL), /* Single threaded by default */
createIntConfig("io-threads", NULL, IMMUTABLE_CONFIG, 1, 128, server.io_threads_num, 1, INTEGER_CONFIG, NULL, NULL), /* Single threaded by default */
createIntConfig("auto-aof-rewrite-percentage", NULL, MODIFIABLE_CONFIG, 0, INT_MAX, server.aof_rewrite_perc, 100, INTEGER_CONFIG, NULL, NULL),
createIntConfig("cluster-replica-validity-factor", "cluster-slave-validity-factor", MODIFIABLE_CONFIG, 0, INT_MAX, server.cluster_slave_validity_factor, 10, INTEGER_CONFIG, NULL, NULL), /* Slave max data age factor. */
createIntConfig("list-max-ziplist-size", NULL, MODIFIABLE_CONFIG, INT_MIN, INT_MAX, server.list_max_ziplist_size, -2, INTEGER_CONFIG, NULL, NULL),
@@ -2209,7 +2162,7 @@ standardConfig configs[] = {
createIntConfig("maxmemory-samples", NULL, MODIFIABLE_CONFIG, 1, INT_MAX, server.maxmemory_samples, 5, INTEGER_CONFIG, NULL, NULL),
createIntConfig("timeout", NULL, MODIFIABLE_CONFIG, 0, INT_MAX, server.maxidletime, 0, INTEGER_CONFIG, NULL, NULL), /* Default client timeout: infinite */
createIntConfig("replica-announce-port", "slave-announce-port", MODIFIABLE_CONFIG, 0, 65535, server.slave_announce_port, 0, INTEGER_CONFIG, NULL, NULL),
createIntConfig("tcp-backlog", NULL, MODIFIABLE_CONFIG, 0, INT_MAX, server.tcp_backlog, 511, INTEGER_CONFIG, NULL, NULL), /* TCP listen backlog. */
createIntConfig("tcp-backlog", NULL, IMMUTABLE_CONFIG, 0, INT_MAX, server.tcp_backlog, 511, INTEGER_CONFIG, NULL, NULL), /* TCP listen backlog. */
createIntConfig("cluster-announce-bus-port", NULL, MODIFIABLE_CONFIG, 0, 65535, server.cluster_announce_bus_port, 0, INTEGER_CONFIG, NULL, NULL), /* Default: Use +10000 offset. */
createIntConfig("cluster-announce-port", NULL, MODIFIABLE_CONFIG, 0, 65535, server.cluster_announce_port, 0, INTEGER_CONFIG, NULL, NULL), /* Use server.port */
createIntConfig("repl-timeout", NULL, MODIFIABLE_CONFIG, 1, INT_MAX, server.repl_timeout, 60, INTEGER_CONFIG, NULL, NULL),
@@ -2217,7 +2170,6 @@ standardConfig configs[] = {
createIntConfig("list-compress-depth", NULL, MODIFIABLE_CONFIG, 0, INT_MAX, server.list_compress_depth, 0, INTEGER_CONFIG, NULL, NULL),
createIntConfig("rdb-key-save-delay", NULL, MODIFIABLE_CONFIG, 0, INT_MAX, server.rdb_key_save_delay, 0, INTEGER_CONFIG, NULL, NULL),
createIntConfig("key-load-delay", NULL, MODIFIABLE_CONFIG, 0, INT_MAX, server.key_load_delay, 0, INTEGER_CONFIG, NULL, NULL),
createIntConfig("tracking-table-max-fill", NULL, MODIFIABLE_CONFIG, 0, 100, server.tracking_table_max_fill, 10, INTEGER_CONFIG, NULL, NULL), /* Default: 10% tracking table max fill. */
createIntConfig("active-expire-effort", NULL, MODIFIABLE_CONFIG, 1, 10, server.active_expire_effort, 1, INTEGER_CONFIG, NULL, NULL), /* From 1 to 10. */
createIntConfig("hz", NULL, MODIFIABLE_CONFIG, 0, INT_MAX, server.config_hz, CONFIG_DEFAULT_HZ, INTEGER_CONFIG, NULL, updateHZ),
createIntConfig("min-replicas-to-write", "min-slaves-to-write", MODIFIABLE_CONFIG, 0, INT_MAX, server.repl_min_slaves_to_write, 0, INTEGER_CONFIG, NULL, updateGoodSlaves),
@@ -2229,15 +2181,16 @@ standardConfig configs[] = {
/* Unsigned Long configs */
createULongConfig("active-defrag-max-scan-fields", NULL, MODIFIABLE_CONFIG, 1, LONG_MAX, server.active_defrag_max_scan_fields, 1000, INTEGER_CONFIG, NULL, NULL), /* Default: keys with more than 1000 fields will be processed separately */
createULongConfig("slowlog-max-len", NULL, MODIFIABLE_CONFIG, 0, LONG_MAX, server.slowlog_max_len, 128, INTEGER_CONFIG, NULL, NULL),
createULongConfig("acllog-max-len", NULL, MODIFIABLE_CONFIG, 0, LONG_MAX, server.acllog_max_len, 128, INTEGER_CONFIG, NULL, NULL),
/* Long Long configs */
createLongLongConfig("lua-time-limit", NULL, MODIFIABLE_CONFIG, 0, LONG_MAX, server.lua_time_limit, 5000, INTEGER_CONFIG, NULL, NULL),/* milliseconds */
createLongLongConfig("cluster-node-timeout", NULL, MODIFIABLE_CONFIG, 0, LLONG_MAX, server.cluster_node_timeout, 15000, INTEGER_CONFIG, NULL, NULL),
createLongLongConfig("slowlog-log-slower-than", NULL, MODIFIABLE_CONFIG, -1, LLONG_MAX, server.slowlog_log_slower_than, 10000, INTEGER_CONFIG, NULL, NULL),
createLongLongConfig("latency-monitor-threshold", NULL, MODIFIABLE_CONFIG, 0, LLONG_MAX, server.latency_monitor_threshold, 0, INTEGER_CONFIG, NULL, NULL),
createLongLongConfig("proto-max-bulk-len", NULL, MODIFIABLE_CONFIG, 0, LONG_MAX, server.proto_max_bulk_len, 512ll*1024*1024, MEMORY_CONFIG, NULL, NULL), /* Bulk request max size */
createLongLongConfig("stream-node-max-entries", NULL, MODIFIABLE_CONFIG, 0, LONG_MAX, server.stream_node_max_entries, 100, INTEGER_CONFIG, NULL, NULL),
createLongLongConfig("repl-backlog-size", NULL, MODIFIABLE_CONFIG, 1, LONG_MAX, server.repl_backlog_size, 1024*1024, MEMORY_CONFIG, NULL, updateReplBacklogSize), /* Default: 1mb */
createLongLongConfig("proto-max-bulk-len", NULL, MODIFIABLE_CONFIG, 0, LLONG_MAX, server.proto_max_bulk_len, 512ll*1024*1024, MEMORY_CONFIG, NULL, NULL), /* Bulk request max size */
createLongLongConfig("stream-node-max-entries", NULL, MODIFIABLE_CONFIG, 0, LLONG_MAX, server.stream_node_max_entries, 100, INTEGER_CONFIG, NULL, NULL),
createLongLongConfig("repl-backlog-size", NULL, MODIFIABLE_CONFIG, 1, LLONG_MAX, server.repl_backlog_size, 1024*1024, MEMORY_CONFIG, NULL, updateReplBacklogSize), /* Default: 1mb */
/* Unsigned Long Long configs */
createULongLongConfig("maxmemory", NULL, MODIFIABLE_CONFIG, 0, ULLONG_MAX, server.maxmemory, 0, MEMORY_CONFIG, NULL, updateMaxmemory),
@@ -2246,11 +2199,12 @@ standardConfig configs[] = {
createSizeTConfig("hash-max-ziplist-entries", NULL, MODIFIABLE_CONFIG, 0, LONG_MAX, server.hash_max_ziplist_entries, 512, INTEGER_CONFIG, NULL, NULL),
createSizeTConfig("set-max-intset-entries", NULL, MODIFIABLE_CONFIG, 0, LONG_MAX, server.set_max_intset_entries, 512, INTEGER_CONFIG, NULL, NULL),
createSizeTConfig("zset-max-ziplist-entries", NULL, MODIFIABLE_CONFIG, 0, LONG_MAX, server.zset_max_ziplist_entries, 128, INTEGER_CONFIG, NULL, NULL),
createSizeTConfig("active-defrag-ignore-bytes", NULL, MODIFIABLE_CONFIG, 1, LONG_MAX, server.active_defrag_ignore_bytes, 100<<20, MEMORY_CONFIG, NULL, NULL), /* Default: don't defrag if frag overhead is below 100mb */
createSizeTConfig("active-defrag-ignore-bytes", NULL, MODIFIABLE_CONFIG, 1, LLONG_MAX, server.active_defrag_ignore_bytes, 100<<20, MEMORY_CONFIG, NULL, NULL), /* Default: don't defrag if frag overhead is below 100mb */
createSizeTConfig("hash-max-ziplist-value", NULL, MODIFIABLE_CONFIG, 0, LONG_MAX, server.hash_max_ziplist_value, 64, MEMORY_CONFIG, NULL, NULL),
createSizeTConfig("stream-node-max-bytes", NULL, MODIFIABLE_CONFIG, 0, LONG_MAX, server.stream_node_max_bytes, 4096, MEMORY_CONFIG, NULL, NULL),
createSizeTConfig("zset-max-ziplist-value", NULL, MODIFIABLE_CONFIG, 0, LONG_MAX, server.zset_max_ziplist_value, 64, MEMORY_CONFIG, NULL, NULL),
createSizeTConfig("hll-sparse-max-bytes", NULL, MODIFIABLE_CONFIG, 0, LONG_MAX, server.hll_sparse_max_bytes, 3000, MEMORY_CONFIG, NULL, NULL),
createSizeTConfig("tracking-table-max-keys", NULL, MODIFIABLE_CONFIG, 0, LONG_MAX, server.tracking_table_max_keys, 1000000, INTEGER_CONFIG, NULL, NULL), /* Default: 1 million keys max. */
/* Other configs */
createTimeTConfig("repl-backlog-ttl", NULL, MODIFIABLE_CONFIG, 0, LONG_MAX, server.repl_backlog_time_limit, 60*60, INTEGER_CONFIG, NULL, NULL), /* Default: 1 hour */
+9 -3
View File
@@ -152,7 +152,7 @@ static void connSocketClose(connection *conn) {
/* If called from within a handler, schedule the close but
* keep the connection until the handler returns.
*/
if (conn->flags & CONN_FLAG_IN_HANDLER) {
if (connHasRefs(conn)) {
conn->flags |= CONN_FLAG_CLOSE_SCHEDULED;
return;
}
@@ -183,10 +183,16 @@ static int connSocketRead(connection *conn, void *buf, size_t buf_len) {
}
static int connSocketAccept(connection *conn, ConnectionCallbackFunc accept_handler) {
int ret = C_OK;
if (conn->state != CONN_STATE_ACCEPTING) return C_ERR;
conn->state = CONN_STATE_CONNECTED;
if (!callHandler(conn, accept_handler)) return C_ERR;
return C_OK;
connIncrRefs(conn);
if (!callHandler(conn, accept_handler)) ret = C_ERR;
connDecrRefs(conn);
return ret;
}
/* Register a write handler, to be called when the connection is writable.
+11 -4
View File
@@ -45,9 +45,8 @@ typedef enum {
CONN_STATE_ERROR
} ConnectionState;
#define CONN_FLAG_IN_HANDLER (1<<0) /* A handler execution is in progress */
#define CONN_FLAG_CLOSE_SCHEDULED (1<<1) /* Closed scheduled by a handler */
#define CONN_FLAG_WRITE_BARRIER (1<<2) /* Write barrier requested */
#define CONN_FLAG_CLOSE_SCHEDULED (1<<0) /* Closed scheduled by a handler */
#define CONN_FLAG_WRITE_BARRIER (1<<1) /* Write barrier requested */
typedef void (*ConnectionCallbackFunc)(struct connection *conn);
@@ -70,7 +69,8 @@ typedef struct ConnectionType {
struct connection {
ConnectionType *type;
ConnectionState state;
int flags;
short int flags;
short int refs;
int last_errno;
void *private_data;
ConnectionCallbackFunc conn_handler;
@@ -88,6 +88,13 @@ struct connection {
* connAccept() may directly call accept_handler(), or return and call it
* at a later time. This behavior is a bit awkward but aims to reduce the need
* to wait for the next event loop, if no additional handshake is required.
*
* IMPORTANT: accept_handler may decide to close the connection, calling connClose().
* To make this safe, the connection is only marked with CONN_FLAG_CLOSE_SCHEDULED
* in this case, and connAccept() returns with an error.
*
* connAccept() callers must always check the return value and on error (C_ERR)
* a connClose() must be called.
*/
static inline int connAccept(connection *conn, ConnectionCallbackFunc accept_handler) {
+28 -25
View File
@@ -37,46 +37,49 @@
* implementations (currently sockets in connection.c and TLS in tls.c).
*
* Currently helpers implement the mechanisms for invoking connection
* handlers, tracking in-handler states and dealing with deferred
* destruction (if invoked by a handler).
* handlers and tracking connection references, to allow safe destruction
* of connections from within a handler.
*/
/* Called whenever a handler is invoked on a connection and sets the
* CONN_FLAG_IN_HANDLER flag to indicate we're in a handler context.
/* Incremenet connection references.
*
* An attempt to close a connection while CONN_FLAG_IN_HANDLER is
* set will result with deferred close, i.e. setting the CONN_FLAG_CLOSE_SCHEDULED
* instead of destructing it.
* Inside a connection handler, we guarantee refs >= 1 so it is always
* safe to connClose().
*
* In other cases where we don't want to prematurely lose the connection,
* it can go beyond 1 as well; currently it is only done by connAccept().
*/
static inline void enterHandler(connection *conn) {
conn->flags |= CONN_FLAG_IN_HANDLER;
static inline void connIncrRefs(connection *conn) {
conn->refs++;
}
/* Called whenever a handler returns. This unsets the CONN_FLAG_IN_HANDLER
* flag and performs actual close/destruction if a deferred close was
* scheduled by the handler.
/* Decrement connection references.
*
* Note that this is not intended to provide any automatic free logic!
* callHandler() takes care of that for the common flows, and anywhere an
* explicit connIncrRefs() is used, the caller is expected to take care of
* that.
*/
static inline int exitHandler(connection *conn) {
conn->flags &= ~CONN_FLAG_IN_HANDLER;
if (conn->flags & CONN_FLAG_CLOSE_SCHEDULED) {
connClose(conn);
return 0;
}
return 1;
static inline void connDecrRefs(connection *conn) {
conn->refs--;
}
static inline int connHasRefs(connection *conn) {
return conn->refs;
}
/* Helper for connection implementations to call handlers:
* 1. Mark the handler in use.
* 1. Increment refs to protect the connection.
* 2. Execute the handler (if set).
* 3. Mark the handler as NOT in use and perform deferred close if was
* requested by the handler at any time.
* 3. Decrement refs and perform deferred close, if refs==0.
*/
static inline int callHandler(connection *conn, ConnectionCallbackFunc handler) {
conn->flags |= CONN_FLAG_IN_HANDLER;
connIncrRefs(conn);
if (handler) handler(conn);
conn->flags &= ~CONN_FLAG_IN_HANDLER;
connDecrRefs(conn);
if (conn->flags & CONN_FLAG_CLOSE_SCHEDULED) {
connClose(conn);
if (!connHasRefs(conn)) connClose(conn);
return 0;
}
return 1;
+142 -47
View File
@@ -182,9 +182,28 @@ void dbAdd(redisDb *db, robj *key, robj *val) {
serverAssertWithInfo(NULL,key,retval == DICT_OK);
if (val->type == OBJ_LIST ||
val->type == OBJ_ZSET)
val->type == OBJ_ZSET ||
val->type == OBJ_STREAM)
signalKeyAsReady(db, key);
if (server.cluster_enabled) slotToKeyAdd(key->ptr);
}
/* This is a special version of dbAdd() that is used only when loading
* keys from the RDB file: the key is passed as an SDS string that is
* retained by the function (and not freed by the caller).
*
* Moreover this function will not abort if the key is already busy, to
* give more control to the caller, nor will signal the key as ready
* since it is not useful in this context.
*
* The function returns 1 if the key was added to the database, taking
* ownership of the SDS string, otherwise 0 is returned, and is up to the
* caller to free the SDS string. */
int dbAddRDBLoad(redisDb *db, sds key, robj *val) {
int retval = dictAdd(db->dict, key, val);
if (retval != DICT_OK) return 0;
if (server.cluster_enabled) slotToKeyAdd(key);
return 1;
}
/* Overwrite an existing key with a new value. Incrementing the reference
@@ -220,7 +239,7 @@ void dbOverwrite(redisDb *db, robj *key, robj *val) {
* unless 'keepttl' is true.
*
* All the new keys in the database should be created via this interface. */
void genericSetKey(redisDb *db, robj *key, robj *val, int keepttl) {
void genericSetKey(redisDb *db, robj *key, robj *val, int keepttl, int signal) {
if (lookupKeyWrite(db,key) == NULL) {
dbAdd(db,key,val);
} else {
@@ -228,12 +247,12 @@ void genericSetKey(redisDb *db, robj *key, robj *val, int keepttl) {
}
incrRefCount(val);
if (!keepttl) removeExpire(db,key);
signalModifiedKey(db,key);
if (signal) signalModifiedKey(db,key);
}
/* Common case for genericSetKey() where the TTL is not retained. */
void setKey(redisDb *db, robj *key, robj *val) {
genericSetKey(db,key,val,0);
genericSetKey(db,key,val,0,1);
}
/* Return true if the specified key exists in the specified database.
@@ -287,7 +306,7 @@ int dbSyncDelete(redisDb *db, robj *key) {
* the key, because it is shared with the main dictionary. */
if (dictSize(db->expires) > 0) dictDelete(db->expires,key->ptr);
if (dictDelete(db->dict,key->ptr) == DICT_OK) {
if (server.cluster_enabled) slotToKeyDel(key);
if (server.cluster_enabled) slotToKeyDel(key->ptr);
return 1;
} else {
return 0;
@@ -347,7 +366,10 @@ robj *dbUnshareStringValue(redisDb *db, robj *key, robj *o) {
* DB number if we want to flush only a single Redis database number.
*
* Flags are be EMPTYDB_NO_FLAGS if no special flags are specified or
* EMPTYDB_ASYNC if we want the memory to be freed in a different thread
* 1. EMPTYDB_ASYNC if we want the memory to be freed in a different thread.
* 2. EMPTYDB_BACKUP if we want to empty the backup dictionaries created by
* disklessLoadMakeBackups. In that case we only free memory and avoid
* firing module events.
* and the function to return ASAP.
*
* On success the fuction returns the number of keys removed from the
@@ -355,6 +377,8 @@ robj *dbUnshareStringValue(redisDb *db, robj *key, robj *o) {
* DB number is out of range, and errno is set to EINVAL. */
long long emptyDbGeneric(redisDb *dbarray, int dbnum, int flags, void(callback)(void*)) {
int async = (flags & EMPTYDB_ASYNC);
int backup = (flags & EMPTYDB_BACKUP); /* Just free the memory, nothing else */
RedisModuleFlushInfoV1 fi = {REDISMODULE_FLUSHINFO_VERSION,!async,dbnum};
long long removed = 0;
if (dbnum < -1 || dbnum >= server.dbnum) {
@@ -362,16 +386,18 @@ long long emptyDbGeneric(redisDb *dbarray, int dbnum, int flags, void(callback)(
return -1;
}
/* Fire the flushdb modules event. */
RedisModuleFlushInfoV1 fi = {REDISMODULE_FLUSHINFO_VERSION,!async,dbnum};
moduleFireServerEvent(REDISMODULE_EVENT_FLUSHDB,
REDISMODULE_SUBEVENT_FLUSHDB_START,
&fi);
/* Pre-flush actions */
if (!backup) {
/* Fire the flushdb modules event. */
moduleFireServerEvent(REDISMODULE_EVENT_FLUSHDB,
REDISMODULE_SUBEVENT_FLUSHDB_START,
&fi);
/* Make sure the WATCHed keys are affected by the FLUSH* commands.
* Note that we need to call the function while the keys are still
* there. */
signalFlushedDb(dbnum);
/* Make sure the WATCHed keys are affected by the FLUSH* commands.
* Note that we need to call the function while the keys are still
* there. */
signalFlushedDb(dbnum);
}
int startdb, enddb;
if (dbnum == -1) {
@@ -390,20 +416,24 @@ long long emptyDbGeneric(redisDb *dbarray, int dbnum, int flags, void(callback)(
dictEmpty(dbarray[j].expires,callback);
}
}
if (server.cluster_enabled) {
if (async) {
slotToKeyFlushAsync();
} else {
slotToKeyFlush();
}
}
if (dbnum == -1) flushSlaveKeysWithExpireList();
/* Also fire the end event. Note that this event will fire almost
* immediately after the start event if the flush is asynchronous. */
moduleFireServerEvent(REDISMODULE_EVENT_FLUSHDB,
REDISMODULE_SUBEVENT_FLUSHDB_END,
&fi);
/* Post-flush actions */
if (!backup) {
if (server.cluster_enabled) {
if (async) {
slotToKeyFlushAsync();
} else {
slotToKeyFlush();
}
}
if (dbnum == -1) flushSlaveKeysWithExpireList();
/* Also fire the end event. Note that this event will fire almost
* immediately after the start event if the flush is asynchronous. */
moduleFireServerEvent(REDISMODULE_EVENT_FLUSHDB,
REDISMODULE_SUBEVENT_FLUSHDB_END,
&fi);
}
return removed;
}
@@ -544,7 +574,7 @@ void delGenericCommand(client *c, int lazy) {
}
void delCommand(client *c) {
delGenericCommand(c,0);
delGenericCommand(c,server.lazyfree_lazy_user_del);
}
void unlinkCommand(client *c) {
@@ -602,7 +632,7 @@ void keysCommand(client *c) {
void *replylen = addReplyDeferredLen(c);
di = dictGetSafeIterator(c->db->dict);
allkeys = (pattern[0] == '*' && pattern[1] == '\0');
allkeys = (pattern[0] == '*' && plen == 1);
while((de = dictNext(di)) != NULL) {
sds key = dictGetKey(de);
robj *keyobj;
@@ -1285,13 +1315,17 @@ int expireIfNeeded(redisDb *db, robj *key) {
propagateExpire(db,key,server.lazyfree_lazy_expire);
notifyKeyspaceEvent(NOTIFY_EXPIRED,
"expired",key,db->id);
return server.lazyfree_lazy_expire ? dbAsyncDelete(db,key) :
dbSyncDelete(db,key);
int retval = server.lazyfree_lazy_expire ? dbAsyncDelete(db,key) :
dbSyncDelete(db,key);
if (retval) signalModifiedKey(db,key);
return retval;
}
/* -----------------------------------------------------------------------------
* API to get key arguments from commands
* ---------------------------------------------------------------------------*/
#define MAX_KEYS_BUFFER 256
static int getKeysTempBuffer[MAX_KEYS_BUFFER];
/* The base case is to use the keys position as given in the command table
* (firstkey, lastkey, step). */
@@ -1306,7 +1340,12 @@ int *getKeysUsingCommandTable(struct redisCommand *cmd,robj **argv, int argc, in
last = cmd->lastkey;
if (last < 0) last = argc+last;
keys = zmalloc(sizeof(int)*((last - cmd->firstkey)+1));
int count = ((last - cmd->firstkey)+1);
keys = getKeysTempBuffer;
if (count > MAX_KEYS_BUFFER)
keys = zmalloc(sizeof(int)*count);
for (j = cmd->firstkey; j <= last; j += cmd->keystep) {
if (j >= argc) {
/* Modules commands, and standard commands with a not fixed number
@@ -1316,7 +1355,7 @@ int *getKeysUsingCommandTable(struct redisCommand *cmd,robj **argv, int argc, in
* return no keys and expect the command implementation to report
* an arity or syntax error. */
if (cmd->flags & CMD_MODULE || cmd->arity < 0) {
zfree(keys);
getKeysFreeResult(keys);
*numkeys = 0;
return NULL;
} else {
@@ -1352,7 +1391,8 @@ int *getKeysFromCommand(struct redisCommand *cmd, robj **argv, int argc, int *nu
/* Free the result of getKeysFromCommand. */
void getKeysFreeResult(int *result) {
zfree(result);
if (result != getKeysTempBuffer)
zfree(result);
}
/* Helper function to extract keys from following commands:
@@ -1373,7 +1413,9 @@ int *zunionInterGetKeys(struct redisCommand *cmd, robj **argv, int argc, int *nu
/* Keys in z{union,inter}store come from two places:
* argv[1] = storage key,
* argv[3...n] = keys to intersect */
keys = zmalloc(sizeof(int)*(num+1));
keys = getKeysTempBuffer;
if (num+1>MAX_KEYS_BUFFER)
keys = zmalloc(sizeof(int)*(num+1));
/* Add all key positions for argv[3...n] to keys[] */
for (i = 0; i < num; i++) keys[i] = 3+i;
@@ -1399,7 +1441,10 @@ int *evalGetKeys(struct redisCommand *cmd, robj **argv, int argc, int *numkeys)
return NULL;
}
keys = zmalloc(sizeof(int)*num);
keys = getKeysTempBuffer;
if (num>MAX_KEYS_BUFFER)
keys = zmalloc(sizeof(int)*num);
*numkeys = num;
/* Add all key positions for argv[3...n] to keys[] */
@@ -1420,7 +1465,7 @@ int *sortGetKeys(struct redisCommand *cmd, robj **argv, int argc, int *numkeys)
UNUSED(cmd);
num = 0;
keys = zmalloc(sizeof(int)*2); /* Alloc 2 places for the worst case. */
keys = getKeysTempBuffer; /* Alloc 2 places for the worst case. */
keys[num++] = 1; /* <sort-key> is always present. */
@@ -1478,7 +1523,10 @@ int *migrateGetKeys(struct redisCommand *cmd, robj **argv, int argc, int *numkey
}
}
keys = zmalloc(sizeof(int)*num);
keys = getKeysTempBuffer;
if (num>MAX_KEYS_BUFFER)
keys = zmalloc(sizeof(int)*num);
for (i = 0; i < num; i++) keys[i] = first+i;
*numkeys = num;
return keys;
@@ -1511,7 +1559,9 @@ int *georadiusGetKeys(struct redisCommand *cmd, robj **argv, int argc, int *numk
* argv[1] = key,
* argv[5...n] = stored key if present
*/
keys = zmalloc(sizeof(int) * num);
keys = getKeysTempBuffer;
if (num>MAX_KEYS_BUFFER)
keys = zmalloc(sizeof(int) * num);
/* Add all key positions to keys[] */
keys[0] = 1;
@@ -1522,6 +1572,48 @@ int *georadiusGetKeys(struct redisCommand *cmd, robj **argv, int argc, int *numk
return keys;
}
/* LCS ... [KEYS <key1> <key2>] ... */
int *lcsGetKeys(struct redisCommand *cmd, robj **argv, int argc, int *numkeys)
{
int i;
int *keys = getKeysTempBuffer;
UNUSED(cmd);
/* We need to parse the options of the command in order to check for the
* "KEYS" argument before the "STRINGS" argument. */
for (i = 1; i < argc; i++) {
char *arg = argv[i]->ptr;
int moreargs = (argc-1) - i;
if (!strcasecmp(arg, "strings")) {
break;
} else if (!strcasecmp(arg, "keys") && moreargs >= 2) {
keys[0] = i+1;
keys[1] = i+2;
*numkeys = 2;
return keys;
}
}
*numkeys = 0;
return keys;
}
/* Helper function to extract keys from memory command.
* MEMORY USAGE <key> */
int *memoryGetKeys(struct redisCommand *cmd, robj **argv, int argc, int *numkeys) {
int *keys;
UNUSED(cmd);
if (argc >= 3 && !strcasecmp(argv[1]->ptr,"usage")) {
keys = getKeysTempBuffer;
keys[0] = 2;
*numkeys = 1;
return keys;
}
*numkeys = 0;
return NULL;
}
/* XREAD [BLOCK <milliseconds>] [COUNT <count>] [GROUP <groupname> <ttl>]
* STREAMS key_1 key_2 ... key_N ID_1 ID_2 ... ID_N */
int *xreadGetKeys(struct redisCommand *cmd, robj **argv, int argc, int *numkeys) {
@@ -1560,7 +1652,10 @@ int *xreadGetKeys(struct redisCommand *cmd, robj **argv, int argc, int *numkeys)
num /= 2; /* We have half the keys as there are arguments because
there are also the IDs, one per key. */
keys = zmalloc(sizeof(int) * num);
keys = getKeysTempBuffer;
if (num>MAX_KEYS_BUFFER)
keys = zmalloc(sizeof(int) * num);
for (i = streams_pos+1; i < argc-num; i++) keys[i-streams_pos-1] = i;
*numkeys = num;
return keys;
@@ -1570,17 +1665,17 @@ int *xreadGetKeys(struct redisCommand *cmd, robj **argv, int argc, int *numkeys)
* a fast way a key that belongs to a specified hash slot. This is useful
* while rehashing the cluster and in other conditions when we need to
* understand if we have keys for a given hash slot. */
void slotToKeyUpdateKey(robj *key, int add) {
unsigned int hashslot = keyHashSlot(key->ptr,sdslen(key->ptr));
void slotToKeyUpdateKey(sds key, int add) {
size_t keylen = sdslen(key);
unsigned int hashslot = keyHashSlot(key,keylen);
unsigned char buf[64];
unsigned char *indexed = buf;
size_t keylen = sdslen(key->ptr);
server.cluster->slots_keys_count[hashslot] += add ? 1 : -1;
if (keylen+2 > 64) indexed = zmalloc(keylen+2);
indexed[0] = (hashslot >> 8) & 0xff;
indexed[1] = hashslot & 0xff;
memcpy(indexed+2,key->ptr,keylen);
memcpy(indexed+2,key,keylen);
if (add) {
raxInsert(server.cluster->slots_to_keys,indexed,keylen+2,NULL,NULL);
} else {
@@ -1589,11 +1684,11 @@ void slotToKeyUpdateKey(robj *key, int add) {
if (indexed != buf) zfree(indexed);
}
void slotToKeyAdd(robj *key) {
void slotToKeyAdd(sds key) {
slotToKeyUpdateKey(key,1);
}
void slotToKeyDel(robj *key) {
void slotToKeyDel(sds key) {
slotToKeyUpdateKey(key,0);
}
+103 -39
View File
@@ -355,6 +355,7 @@ void debugCommand(client *c) {
"CRASH-AND-RECOVER <milliseconds> -- Hard crash and restart after <milliseconds> delay.",
"DIGEST -- Output a hex signature representing the current DB content.",
"DIGEST-VALUE <key-1> ... <key-N>-- Output a hex signature of the values of all the specified keys.",
"DEBUG PROTOCOL [string|integer|double|bignum|null|array|set|map|attrib|push|verbatim|true|false]",
"ERROR <string> -- Return a Redis protocol error with <string> as message. Useful for clients unit tests to simulate Redis errors.",
"LOG <message> -- write message to the server log.",
"HTSTATS <dbid> -- Return hash table statistics of the specified Redis database.",
@@ -362,9 +363,10 @@ void debugCommand(client *c) {
"LOADAOF -- Flush the AOF buffers on disk and reload the AOF in memory.",
"LUA-ALWAYS-REPLICATE-COMMANDS <0|1> -- Setting it to 1 makes Lua replication defaulting to replicating single commands, without the script having to enable effects replication.",
"OBJECT <key> -- Show low level info about key and associated value.",
"OOM -- Crash the server simulating an out-of-memory error.",
"PANIC -- Crash the server simulating a panic.",
"POPULATE <count> [prefix] [size] -- Create <count> string keys named key:<num>. If a prefix is specified is used instead of the 'key' prefix.",
"RELOAD -- Save the RDB on disk and reload it back in memory.",
"RELOAD [MERGE] [NOFLUSH] [NOSAVE] -- Save the RDB on disk and reload it back in memory. By default it will save the RDB file and load it back. With the NOFLUSH option the current database is not removed before loading the new one, but conficts in keys will kill the server with an exception. When MERGE is used, conflicting keys will be loaded (the key in the loaded RDB file will win). When NOSAVE is used, the server will not save the current dataset in the RDB file before loading. Use DEBUG RELOAD NOSAVE when you want just to load the RDB file you placed in the Redis working directory in order to replace the current dataset in memory. Use DEBUG RELOAD NOSAVE NOFLUSH MERGE when you want to add what is in the current RDB file placed in the Redis current directory, with the current memory content. Use DEBUG RELOAD when you want to verify Redis is able to persist the current dataset in the RDB file, flush the memory content, and load it back.",
"RESTART -- Graceful restart: save config, db, restart.",
"SDSLEN <key> -- Show low level SDS string info representing key and value.",
"SEGFAULT -- Crash the server with sigsegv.",
@@ -409,15 +411,44 @@ NULL
serverLog(LL_WARNING, "DEBUG LOG: %s", (char*)c->argv[2]->ptr);
addReply(c,shared.ok);
} else if (!strcasecmp(c->argv[1]->ptr,"reload")) {
rdbSaveInfo rsi, *rsiptr;
rsiptr = rdbPopulateSaveInfo(&rsi);
if (rdbSave(server.rdb_filename,rsiptr) != C_OK) {
addReply(c,shared.err);
return;
int flush = 1, save = 1;
int flags = RDBFLAGS_NONE;
/* Parse the additional options that modify the RELOAD
* behavior. */
for (int j = 2; j < c->argc; j++) {
char *opt = c->argv[j]->ptr;
if (!strcasecmp(opt,"MERGE")) {
flags |= RDBFLAGS_ALLOW_DUP;
} else if (!strcasecmp(opt,"NOFLUSH")) {
flush = 0;
} else if (!strcasecmp(opt,"NOSAVE")) {
save = 0;
} else {
addReplyError(c,"DEBUG RELOAD only supports the "
"MERGE, NOFLUSH and NOSAVE options.");
return;
}
}
emptyDb(-1,EMPTYDB_NO_FLAGS,NULL);
/* The default beahvior is to save the RDB file before loading
* it back. */
if (save) {
rdbSaveInfo rsi, *rsiptr;
rsiptr = rdbPopulateSaveInfo(&rsi);
if (rdbSave(server.rdb_filename,rsiptr) != C_OK) {
addReply(c,shared.err);
return;
}
}
/* The default behavior is to remove the current dataset from
* memory before loading the RDB file, however when MERGE is
* used together with NOFLUSH, we are able to merge two datasets. */
if (flush) emptyDb(-1,EMPTYDB_NO_FLAGS,NULL);
protectClient(c);
int ret = rdbLoad(server.rdb_filename,NULL,RDBFLAGS_NONE);
int ret = rdbLoad(server.rdb_filename,NULL,flags);
unprotectClient(c);
if (ret != C_OK) {
addReplyError(c,"Error trying to load the RDB dump");
@@ -488,7 +519,7 @@ NULL
"encoding:%s serializedlength:%zu "
"lru:%d lru_seconds_idle:%llu%s",
(void*)val, val->refcount,
strenc, rdbSavedObjectLen(val),
strenc, rdbSavedObjectLen(val, c->argv[2]),
val->lru, estimateObjectIdleTime(val)/1000, extra);
} else if (!strcasecmp(c->argv[1]->ptr,"sdslen") && c->argc == 3) {
dictEntry *de;
@@ -586,7 +617,7 @@ NULL
}
} else if (!strcasecmp(c->argv[1]->ptr,"protocol") && c->argc == 3) {
/* DEBUG PROTOCOL [string|integer|double|bignum|null|array|set|map|
* attrib|push|verbatim|true|false|state|err|bloberr] */
* attrib|push|verbatim|true|false] */
char *name = c->argv[2]->ptr;
if (!strcasecmp(name,"string")) {
addReplyBulkCString(c,"Hello World");
@@ -634,7 +665,7 @@ NULL
} else if (!strcasecmp(name,"verbatim")) {
addReplyVerbatim(c,"This is a verbatim\nstring",25,"txt");
} else {
addReplyError(c,"Wrong protocol type name. Please use one of the following: string|integer|double|bignum|null|array|set|map|attrib|push|verbatim|true|false|state|err|bloberr");
addReplyError(c,"Wrong protocol type name. Please use one of the following: string|integer|double|bignum|null|array|set|map|attrib|push|verbatim|true|false");
}
} else if (!strcasecmp(c->argv[1]->ptr,"sleep") && c->argc == 3) {
double dtime = strtod(c->argv[2]->ptr,NULL);
@@ -683,9 +714,12 @@ NULL
sds stats = sdsempty();
char buf[4096];
if (getLongFromObjectOrReply(c, c->argv[2], &dbid, NULL) != C_OK)
if (getLongFromObjectOrReply(c, c->argv[2], &dbid, NULL) != C_OK) {
sdsfree(stats);
return;
}
if (dbid < 0 || dbid >= server.dbnum) {
sdsfree(stats);
addReplyError(c,"Out of range database");
return;
}
@@ -812,6 +846,8 @@ void serverLogObjectDebugInfo(const robj *o) {
serverLog(LL_WARNING,"Sorted set size: %d", (int) zsetLength(o));
if (o->encoding == OBJ_ENCODING_SKIPLIST)
serverLog(LL_WARNING,"Skiplist level: %d", (int) ((const zset*)o->ptr)->zsl->level);
} else if (o->type == OBJ_STREAM) {
serverLog(LL_WARNING,"Stream size: %d", (int) streamLength(o));
}
}
@@ -1040,6 +1076,61 @@ void logRegisters(ucontext_t *uc) {
(unsigned long) uc->uc_mcontext.gregs[18]
);
logStackContent((void**)uc->uc_mcontext.gregs[15]);
#elif defined(__aarch64__) /* Linux AArch64 */
serverLog(LL_WARNING,
"\n"
"X18:%016lx X19:%016lx\nX20:%016lx X21:%016lx\n"
"X22:%016lx X23:%016lx\nX24:%016lx X25:%016lx\n"
"X26:%016lx X27:%016lx\nX28:%016lx X29:%016lx\n"
"X30:%016lx\n"
"pc:%016lx sp:%016lx\npstate:%016lx fault_address:%016lx\n",
(unsigned long) uc->uc_mcontext.regs[18],
(unsigned long) uc->uc_mcontext.regs[19],
(unsigned long) uc->uc_mcontext.regs[20],
(unsigned long) uc->uc_mcontext.regs[21],
(unsigned long) uc->uc_mcontext.regs[22],
(unsigned long) uc->uc_mcontext.regs[23],
(unsigned long) uc->uc_mcontext.regs[24],
(unsigned long) uc->uc_mcontext.regs[25],
(unsigned long) uc->uc_mcontext.regs[26],
(unsigned long) uc->uc_mcontext.regs[27],
(unsigned long) uc->uc_mcontext.regs[28],
(unsigned long) uc->uc_mcontext.regs[29],
(unsigned long) uc->uc_mcontext.regs[30],
(unsigned long) uc->uc_mcontext.pc,
(unsigned long) uc->uc_mcontext.sp,
(unsigned long) uc->uc_mcontext.pstate,
(unsigned long) uc->uc_mcontext.fault_address
);
logStackContent((void**)uc->uc_mcontext.sp);
#elif defined(__arm__) /* Linux ARM */
serverLog(LL_WARNING,
"\n"
"R10:%016lx R9 :%016lx\nR8 :%016lx R7 :%016lx\n"
"R6 :%016lx R5 :%016lx\nR4 :%016lx R3 :%016lx\n"
"R2 :%016lx R1 :%016lx\nR0 :%016lx EC :%016lx\n"
"fp: %016lx ip:%016lx\n",
"pc:%016lx sp:%016lx\ncpsr:%016lx fault_address:%016lx\n",
(unsigned long) uc->uc_mcontext.arm_r10,
(unsigned long) uc->uc_mcontext.arm_r9,
(unsigned long) uc->uc_mcontext.arm_r8,
(unsigned long) uc->uc_mcontext.arm_r7,
(unsigned long) uc->uc_mcontext.arm_r6,
(unsigned long) uc->uc_mcontext.arm_r5,
(unsigned long) uc->uc_mcontext.arm_r4,
(unsigned long) uc->uc_mcontext.arm_r3,
(unsigned long) uc->uc_mcontext.arm_r2,
(unsigned long) uc->uc_mcontext.arm_r1,
(unsigned long) uc->uc_mcontext.arm_r0,
(unsigned long) uc->uc_mcontext.error_code,
(unsigned long) uc->uc_mcontext.arm_fp,
(unsigned long) uc->uc_mcontext.arm_ip,
(unsigned long) uc->uc_mcontext.arm_pc,
(unsigned long) uc->uc_mcontext.arm_sp,
(unsigned long) uc->uc_mcontext.arm_cpsr,
(unsigned long) uc->uc_mcontext.fault_address
);
logStackContent((void**)uc->uc_mcontext.arm_sp);
#endif
#elif defined(__FreeBSD__)
#if defined(__x86_64__)
@@ -1180,33 +1271,6 @@ void logRegisters(ucontext_t *uc) {
(unsigned long) uc->uc_mcontext.mc_cs
);
logStackContent((void**)uc->uc_mcontext.mc_rsp);
#elif defined(__aarch64__) /* Linux AArch64 */
serverLog(LL_WARNING,
"\n"
"X18:%016lx X19:%016lx\nX20:%016lx X21:%016lx\n"
"X22:%016lx X23:%016lx\nX24:%016lx X25:%016lx\n"
"X26:%016lx X27:%016lx\nX28:%016lx X29:%016lx\n"
"X30:%016lx\n"
"pc:%016lx sp:%016lx\npstate:%016lx fault_address:%016lx\n",
(unsigned long) uc->uc_mcontext.regs[18],
(unsigned long) uc->uc_mcontext.regs[19],
(unsigned long) uc->uc_mcontext.regs[20],
(unsigned long) uc->uc_mcontext.regs[21],
(unsigned long) uc->uc_mcontext.regs[22],
(unsigned long) uc->uc_mcontext.regs[23],
(unsigned long) uc->uc_mcontext.regs[24],
(unsigned long) uc->uc_mcontext.regs[25],
(unsigned long) uc->uc_mcontext.regs[26],
(unsigned long) uc->uc_mcontext.regs[27],
(unsigned long) uc->uc_mcontext.regs[28],
(unsigned long) uc->uc_mcontext.regs[29],
(unsigned long) uc->uc_mcontext.regs[30],
(unsigned long) uc->uc_mcontext.pc,
(unsigned long) uc->uc_mcontext.sp,
(unsigned long) uc->uc_mcontext.pstate,
(unsigned long) uc->uc_mcontext.fault_address
);
logStackContent((void**)uc->uc_mcontext.sp);
#else
serverLog(LL_WARNING,
" Dumping of registers not supported for this OS/arch");
+67 -29
View File
@@ -5,8 +5,8 @@
* We do that by scanning the keyspace and for each pointer we have, we can try to
* ask the allocator if moving it to a new address will help reduce fragmentation.
*
* Copyright (c) 2017, Oran Agra
* Copyright (c) 2017, Redis Labs, Inc
* Copyright (c) 2020, Oran Agra
* Copyright (c) 2020, Redis Labs, Inc
* All rights reserved.
*
* Redistribution and use in source and binary forms, with or without
@@ -408,25 +408,32 @@ dictEntry* replaceSateliteDictKeyPtrAndOrDefragDictEntry(dict *d, sds oldkey, sd
return NULL;
}
long activeDefragQuickListNodes(quicklist *ql) {
quicklistNode *node = ql->head, *newnode;
long activeDefragQuickListNode(quicklist *ql, quicklistNode **node_ref) {
quicklistNode *newnode, *node = *node_ref;
long defragged = 0;
unsigned char *newzl;
if ((newnode = activeDefragAlloc(node))) {
if (newnode->prev)
newnode->prev->next = newnode;
else
ql->head = newnode;
if (newnode->next)
newnode->next->prev = newnode;
else
ql->tail = newnode;
*node_ref = node = newnode;
defragged++;
}
if ((newzl = activeDefragAlloc(node->zl)))
defragged++, node->zl = newzl;
return defragged;
}
long activeDefragQuickListNodes(quicklist *ql) {
quicklistNode *node = ql->head;
long defragged = 0;
while (node) {
if ((newnode = activeDefragAlloc(node))) {
if (newnode->prev)
newnode->prev->next = newnode;
else
ql->head = newnode;
if (newnode->next)
newnode->next->prev = newnode;
else
ql->tail = newnode;
node = newnode;
defragged++;
}
if ((newzl = activeDefragAlloc(node->zl)))
defragged++, node->zl = newzl;
defragged += activeDefragQuickListNode(ql, &node);
node = node->next;
}
return defragged;
@@ -440,12 +447,48 @@ void defragLater(redisDb *db, dictEntry *kde) {
listAddNodeTail(db->defrag_later, key);
}
long scanLaterList(robj *ob) {
/* returns 0 if no more work needs to be been done, and 1 if time is up and more work is needed. */
long scanLaterList(robj *ob, unsigned long *cursor, long long endtime, long long *defragged) {
quicklist *ql = ob->ptr;
quicklistNode *node;
long iterations = 0;
int bookmark_failed = 0;
if (ob->type != OBJ_LIST || ob->encoding != OBJ_ENCODING_QUICKLIST)
return 0;
server.stat_active_defrag_scanned+=ql->len;
return activeDefragQuickListNodes(ql);
if (*cursor == 0) {
/* if cursor is 0, we start new iteration */
node = ql->head;
} else {
node = quicklistBookmarkFind(ql, "_AD");
if (!node) {
/* if the bookmark was deleted, it means we reached the end. */
*cursor = 0;
return 0;
}
node = node->next;
}
(*cursor)++;
while (node) {
(*defragged) += activeDefragQuickListNode(ql, &node);
server.stat_active_defrag_scanned++;
if (++iterations > 128 && !bookmark_failed) {
if (ustime() > endtime) {
if (!quicklistBookmarkCreate(&ql, "_AD", node)) {
bookmark_failed = 1;
} else {
ob->ptr = ql; /* bookmark creation may have re-allocated the quicklist */
return 1;
}
}
iterations = 0;
}
node = node->next;
}
quicklistBookmarkDelete(ql, "_AD");
*cursor = 0;
return bookmark_failed? 1: 0;
}
typedef struct {
@@ -638,7 +681,8 @@ int scanLaterStraemListpacks(robj *ob, unsigned long *cursor, long long endtime,
void *newdata = activeDefragAlloc(ri.data);
if (newdata)
raxSetData(ri.node, ri.data=newdata), (*defragged)++;
if (++iterations > 16) {
server.stat_active_defrag_scanned++;
if (++iterations > 128) {
if (ustime() > endtime) {
serverAssert(ri.key_len==sizeof(last));
memcpy(last,ri.key,ri.key_len);
@@ -900,8 +944,7 @@ int defragLaterItem(dictEntry *de, unsigned long *cursor, long long endtime) {
if (de) {
robj *ob = dictGetVal(de);
if (ob->type == OBJ_LIST) {
server.stat_active_defrag_hits += scanLaterList(ob);
*cursor = 0; /* list has no scan, we must finish it in one go */
return scanLaterList(ob, cursor, endtime, &server.stat_active_defrag_hits);
} else if (ob->type == OBJ_SET) {
server.stat_active_defrag_hits += scanLaterSet(ob, cursor);
} else if (ob->type == OBJ_ZSET) {
@@ -961,11 +1004,6 @@ int defragLaterStep(redisDb *db, long long endtime) {
if (defragLaterItem(de, &defrag_later_cursor, endtime))
quit = 1; /* time is up, we didn't finish all the work */
/* Don't start a new BIG key in this loop, this is because the
* next key can be a list, and scanLaterList must be done in once cycle */
if (!defrag_later_cursor)
quit = 1;
/* Once in 16 scan iterations, 512 pointer reallocations, or 64 fields
* (if we have a lot of pointers in one hash bucket, or rehashing),
* check if we reached the time limit. */
+8 -1
View File
@@ -134,7 +134,7 @@ int _dictInit(dict *d, dictType *type,
* but with the invariant of a USED/BUCKETS ratio near to <= 1 */
int dictResize(dict *d)
{
int minimal;
unsigned long minimal;
if (!dict_can_resize || dictIsRehashing(d)) return DICT_ERR;
minimal = d->ht[0].used;
@@ -871,6 +871,10 @@ unsigned long dictScan(dict *d,
if (dictSize(d) == 0) return 0;
/* Having a safe iterator means no rehashing can happen, see _dictRehashStep.
* This is needed in case the scan callback tries to do dictFind or alike. */
d->iterators++;
if (!dictIsRehashing(d)) {
t0 = &(d->ht[0]);
m0 = t0->sizemask;
@@ -937,6 +941,9 @@ unsigned long dictScan(dict *d,
} while (v & (m0 ^ m1));
}
/* undo the ++ at the top */
d->iterators--;
return v;
}
+8 -4
View File
@@ -203,8 +203,10 @@ void activeExpireCycle(int type) {
* distribute the time evenly across DBs. */
current_db++;
/* Continue to expire if at the end of the cycle more than 25%
* of the keys were expired. */
/* Continue to expire if at the end of the cycle there are still
* a big percentage of keys to expire, compared to the number of keys
* we scanned. The percentage, stored in config_cycle_acceptable_stale
* is not fixed, but depends on the Redis configured "expire effort". */
do {
unsigned long num, slots;
long long now, ttl_sum;
@@ -305,8 +307,9 @@ void activeExpireCycle(int type) {
}
/* We don't repeat the cycle for the current database if there are
* an acceptable amount of stale keys (logically expired but yet
* not reclained). */
} while ((expired*100/sampled) > config_cycle_acceptable_stale);
* not reclaimed). */
} while (sampled == 0 ||
(expired*100/sampled) > config_cycle_acceptable_stale);
}
elapsed = ustime()-start;
@@ -587,6 +590,7 @@ void pttlCommand(client *c) {
void persistCommand(client *c) {
if (lookupKeyWrite(c->db,c->argv[1])) {
if (removeExpire(c->db,c->argv[1])) {
notifyKeyspaceEvent(NOTIFY_GENERIC,"persist",c->argv[1],c->db->id);
addReply(c,shared.cone);
server.dirty++;
} else {
+1
View File
@@ -1535,6 +1535,7 @@ void pfdebugCommand(client *c) {
sds decoded = sdsempty();
if (hdr->encoding != HLL_SPARSE) {
sdsfree(decoded);
addReplyError(c,"HLL encoding is not sparse");
return;
}
+1 -1
View File
@@ -85,7 +85,7 @@ int THPGetAnonHugePagesSize(void) {
/* ---------------------------- Latency API --------------------------------- */
/* Latency monitor initialization. We just need to create the dictionary
* of time series, each time serie is craeted on demand in order to avoid
* of time series, each time serie is created on demand in order to avoid
* having a fixed list to maintain. */
void latencyMonitorInit(void) {
server.latency_events = dictCreate(&latencyTimeSeriesDictType,NULL);
+1 -1
View File
@@ -83,7 +83,7 @@ int dbAsyncDelete(redisDb *db, robj *key) {
* field to NULL in order to lazy free it later. */
if (de) {
dictFreeUnlinkedEntry(db->dict,de);
if (server.cluster_enabled) slotToKeyDel(key);
if (server.cluster_enabled) slotToKeyDel(key->ptr);
return 1;
} else {
return 0;
+159 -59
View File
@@ -714,9 +714,9 @@ void RM_KeyAtPos(RedisModuleCtx *ctx, int pos) {
* flags into the command flags used by the Redis core.
*
* It returns the set of flags, or -1 if unknown flags are found. */
int commandFlagsFromString(char *s) {
int64_t commandFlagsFromString(char *s) {
int count, j;
int flags = 0;
int64_t flags = 0;
sds *tokens = sdssplitlen(s,strlen(s)," ",1,&count);
for (j = 0; j < count; j++) {
char *t = tokens[j];
@@ -730,6 +730,7 @@ int commandFlagsFromString(char *s) {
else if (!strcasecmp(t,"random")) flags |= CMD_RANDOM;
else if (!strcasecmp(t,"allow-stale")) flags |= CMD_STALE;
else if (!strcasecmp(t,"no-monitor")) flags |= CMD_SKIP_MONITOR;
else if (!strcasecmp(t,"no-slowlog")) flags |= CMD_SKIP_SLOWLOG;
else if (!strcasecmp(t,"fast")) flags |= CMD_FAST;
else if (!strcasecmp(t,"no-auth")) flags |= CMD_NO_AUTH;
else if (!strcasecmp(t,"getkeys-api")) flags |= CMD_MODULE_GETKEYS;
@@ -781,6 +782,8 @@ int commandFlagsFromString(char *s) {
* this means.
* * **"no-monitor"**: Don't propagate the command on monitor. Use this if
* the command has sensible data among the arguments.
* * **"no-slowlog"**: Don't log this command in the slowlog. Use this if
* the command has sensible data among the arguments.
* * **"fast"**: The command time complexity is not greater
* than O(log(N)) where N is the size of the collection or
* anything else representing the normal scalability
@@ -798,7 +801,7 @@ int commandFlagsFromString(char *s) {
* to authenticate a client.
*/
int RM_CreateCommand(RedisModuleCtx *ctx, const char *name, RedisModuleCmdFunc cmdfunc, const char *strflags, int firstkey, int lastkey, int keystep) {
int flags = strflags ? commandFlagsFromString((char*)strflags) : 0;
int64_t flags = strflags ? commandFlagsFromString((char*)strflags) : 0;
if (flags == -1) return REDISMODULE_ERR;
if ((flags & CMD_MODULE_NO_CLUSTER) && server.cluster_enabled)
return REDISMODULE_ERR;
@@ -859,6 +862,7 @@ void RM_SetModuleAttribs(RedisModuleCtx *ctx, const char *name, int ver, int api
module->in_call = 0;
module->in_hook = 0;
module->options = 0;
module->info_cb = 0;
ctx->module = module;
}
@@ -889,7 +893,8 @@ void RM_SetModuleOptions(RedisModuleCtx *ctx, int options) {
ctx->module->options = options;
}
/* Signals that the key is modified from user's perspective (i.e. invalidate WATCH). */
/* Signals that the key is modified from user's perspective (i.e. invalidate WATCH
* and client side caching). */
int RM_SignalModifiedKey(RedisModuleCtx *ctx, RedisModuleString *keyname) {
signalModifiedKey(ctx->client->db,keyname);
return REDISMODULE_OK;
@@ -1037,6 +1042,17 @@ RedisModuleString *RM_CreateStringFromLongLong(RedisModuleCtx *ctx, long long ll
return RM_CreateString(ctx,buf,len);
}
/* Like RedisModule_CreatString(), but creates a string starting from a double
* integer instead of taking a buffer and its length.
*
* The returned string must be released with RedisModule_FreeString() or by
* enabling automatic memory management. */
RedisModuleString *RM_CreateStringFromDouble(RedisModuleCtx *ctx, double d) {
char buf[128];
size_t len = d2string(buf,sizeof(buf),d);
return RM_CreateString(ctx,buf,len);
}
/* Like RedisModule_CreatString(), but creates a string starting from a long
* double.
*
@@ -1779,7 +1795,12 @@ int RM_GetSelectedDb(RedisModuleCtx *ctx) {
* current request context (whether the client is a Lua script or in a MULTI),
* and about the Redis instance in general, i.e replication and persistence.
*
* The available flags are:
* It is possible to call this function even with a NULL context, however
* in this case the following flags will not be reported:
*
* * LUA, MULTI, REPLICATED, DIRTY (see below for more info).
*
* Available flags and their meaning:
*
* * REDISMODULE_CTX_FLAGS_LUA: The command is running in a Lua script
*
@@ -1832,14 +1853,22 @@ int RM_GetContextFlags(RedisModuleCtx *ctx) {
int flags = 0;
/* Client specific flags */
if (ctx->client) {
if (ctx->client->flags & CLIENT_LUA)
flags |= REDISMODULE_CTX_FLAGS_LUA;
if (ctx->client->flags & CLIENT_MULTI)
flags |= REDISMODULE_CTX_FLAGS_MULTI;
/* Module command recieved from MASTER, is replicated. */
if (ctx->client->flags & CLIENT_MASTER)
flags |= REDISMODULE_CTX_FLAGS_REPLICATED;
if (ctx) {
if (ctx->client) {
if (ctx->client->flags & CLIENT_LUA)
flags |= REDISMODULE_CTX_FLAGS_LUA;
if (ctx->client->flags & CLIENT_MULTI)
flags |= REDISMODULE_CTX_FLAGS_MULTI;
/* Module command recieved from MASTER, is replicated. */
if (ctx->client->flags & CLIENT_MASTER)
flags |= REDISMODULE_CTX_FLAGS_REPLICATED;
}
/* For DIRTY flags, we need the blocked client if used */
client *c = ctx->blocked_client ? ctx->blocked_client->client : ctx->client;
if (c && (c->flags & (CLIENT_DIRTY_CAS|CLIENT_DIRTY_EXEC))) {
flags |= REDISMODULE_CTX_FLAGS_MULTI_DIRTY;
}
}
if (server.cluster_enabled)
@@ -2128,7 +2157,7 @@ RedisModuleString *RM_RandomKey(RedisModuleCtx *ctx) {
int RM_StringSet(RedisModuleKey *key, RedisModuleString *str) {
if (!(key->mode & REDISMODULE_WRITE) || key->iter) return REDISMODULE_ERR;
RM_DeleteKey(key);
setKey(key->db,key->key,str);
genericSetKey(key->db,key->key,str,0,0);
key->value = str;
return REDISMODULE_OK;
}
@@ -2208,7 +2237,7 @@ int RM_StringTruncate(RedisModuleKey *key, size_t newlen) {
if (key->value == NULL) {
/* Empty key: create it with the new size. */
robj *o = createObject(OBJ_STRING,sdsnewlen(NULL, newlen));
setKey(key->db,key->key,o);
genericSetKey(key->db,key->key,o,0,0);
key->value = o;
decrRefCount(o);
} else {
@@ -3297,13 +3326,8 @@ RedisModuleCallReply *RM_Call(RedisModuleCtx *ctx, const char *cmdname, const ch
* a Lua script in the context of AOF and slaves. */
if (replicate) moduleReplicateMultiIfNeeded(ctx);
if (ctx->client->flags & CLIENT_MULTI ||
ctx->flags & REDISMODULE_CTX_MULTI_EMITTED) {
c->flags |= CLIENT_MULTI;
}
/* Run the command */
int call_flags = CMD_CALL_SLOWLOG | CMD_CALL_STATS;
int call_flags = CMD_CALL_SLOWLOG | CMD_CALL_STATS | CMD_CALL_NOWRAP;
if (replicate) {
if (!(flags & REDISMODULE_ARGV_NO_AOF))
call_flags |= CMD_CALL_PROPAGATE_AOF;
@@ -3312,9 +3336,7 @@ RedisModuleCallReply *RM_Call(RedisModuleCtx *ctx, const char *cmdname, const ch
}
call(c,call_flags);
/* Convert the result of the Redis command into a suitable Lua type.
* The first thing we need is to create a single string from the client
* output buffers. */
/* Convert the result of the Redis command into a module reply. */
sds proto = sdsnewlen(c->buf,c->bufpos);
c->bufpos = 0;
while(listLength(c->reply)) {
@@ -3518,6 +3540,8 @@ void moduleTypeNameByID(char *name, uint64_t moduleid) {
* // Optional fields
* .digest = myType_DigestCallBack,
* .mem_usage = myType_MemUsageCallBack,
* .aux_load = myType_AuxRDBLoadCallBack,
* .aux_save = myType_AuxRDBSaveCallBack,
* }
*
* * **rdb_load**: A callback function pointer that loads data from RDB files.
@@ -3525,6 +3549,10 @@ void moduleTypeNameByID(char *name, uint64_t moduleid) {
* * **aof_rewrite**: A callback function pointer that rewrites data as commands.
* * **digest**: A callback function pointer that is used for `DEBUG DIGEST`.
* * **free**: A callback function pointer that can free a type value.
* * **aux_save**: A callback function pointer that saves out of keyspace data to RDB files.
* 'when' argument is either REDISMODULE_AUX_BEFORE_RDB or REDISMODULE_AUX_AFTER_RDB.
* * **aux_load**: A callback function pointer that loads out of keyspace data from RDB files.
* Similar to aux_save, returns REDISMODULE_OK on success, and ERR otherwise.
*
* The **digest* and **mem_usage** methods should currently be omitted since
* they are not yet implemented inside the Redis modules core.
@@ -3597,7 +3625,7 @@ int RM_ModuleTypeSetValue(RedisModuleKey *key, moduleType *mt, void *value) {
if (!(key->mode & REDISMODULE_WRITE) || key->iter) return REDISMODULE_ERR;
RM_DeleteKey(key);
robj *o = createModuleObject(mt,value);
setKey(key->db,key->key,o);
genericSetKey(key->db,key->key,o,0,0);
decrRefCount(o);
key->value = o;
return REDISMODULE_OK;
@@ -3642,14 +3670,15 @@ void moduleRDBLoadError(RedisModuleIO *io) {
io->error = 1;
return;
}
serverLog(LL_WARNING,
serverPanic(
"Error loading data from RDB (short read or EOF). "
"Read performed by module '%s' about type '%s' "
"after reading '%llu' bytes of a value.",
"after reading '%llu' bytes of a value "
"for key named: '%s'.",
io->type->module->name,
io->type->name,
(unsigned long long)io->bytes);
exit(1);
(unsigned long long)io->bytes,
io->key? (char*)io->key->ptr: "(null)");
}
/* Returns 0 if there's at least one registered data type that did not declare
@@ -3895,7 +3924,7 @@ void RM_SaveLongDouble(RedisModuleIO *io, long double value) {
/* Long double has different number of bits in different platforms, so we
* save it as a string type. */
size_t len = ld2string(buf,sizeof(buf),value,LD_STR_HEX);
RM_SaveStringBuffer(io,buf,len+1); /* len+1 for '\0' */
RM_SaveStringBuffer(io,buf,len);
}
/* In the context of the rdb_save method of a module data type, loads back the
@@ -4271,6 +4300,24 @@ void unblockClientFromModule(client *c) {
moduleFreeContext(&ctx);
}
/* If we made it here and client is still blocked it means that the command
* timed-out, client was killed or disconnected and disconnect_callback was
* not implemented (or it was, but RM_UnblockClient was not called from
* within it, as it should).
* We must call moduleUnblockClient in order to free privdata and
* RedisModuleBlockedClient.
*
* Note that we only do that for clients that are blocked on keys, for which
* the contract is that the module should not call RM_UnblockClient under
* normal circumstances.
* Clients implementing threads and working with private data should be
* aware that calling RM_UnblockClient for every blocked client is their
* responsibility, and if they fail to do so memory may leak. Ideally they
* should implement the disconnect and timeout callbacks and call
* RM_UnblockClient, but any other way is also acceptable. */
if (bc->blocked_on_keys && !bc->unblocked)
moduleUnblockClient(c);
bc->client = NULL;
/* Reset the client for a new query since, for blocking commands implemented
* into modules, we do not it immediately after the command returns (and
@@ -4346,14 +4393,17 @@ RedisModuleBlockedClient *moduleBlockClient(RedisModuleCtx *ctx, RedisModuleCmdF
* can really be unblocked, since the module was able to serve the client.
* If the callback returns REDISMODULE_OK, then the client can be unblocked,
* otherwise the client remains blocked and we'll retry again when one of
* the keys it blocked for becomes "ready" again. */
* the keys it blocked for becomes "ready" again.
* This function returns 1 if client was served (and should be unblocked) */
int moduleTryServeClientBlockedOnKey(client *c, robj *key) {
int served = 0;
RedisModuleBlockedClient *bc = c->bpop.module_blocked_handle;
/* Protect against re-processing: don't serve clients that are already
* in the unblocking list for any reason (including RM_UnblockClient()
* explicit call). */
if (bc->unblocked) return REDISMODULE_ERR;
* explicit call). See #6798. */
if (bc->unblocked) return 0;
RedisModuleCtx ctx = REDISMODULE_CTX_INIT;
ctx.flags |= REDISMODULE_CTX_BLOCKED_REPLY;
ctx.blocked_ready_key = key;
@@ -4382,6 +4432,10 @@ int moduleTryServeClientBlockedOnKey(client *c, robj *key) {
*
* free_privdata: called in order to free the private data that is passed
* by RedisModule_UnblockClient() call.
*
* Note: RedisModule_UnblockClient should be called for every blocked client,
* even if client was killed, timed-out or disconnected. Failing to do so
* will result in memory leaks.
*/
RedisModuleBlockedClient *RM_BlockClient(RedisModuleCtx *ctx, RedisModuleCmdFunc reply_callback, RedisModuleCmdFunc timeout_callback, void (*free_privdata)(RedisModuleCtx*,void*), long long timeout_ms) {
return moduleBlockClient(ctx,reply_callback,timeout_callback,free_privdata,timeout_ms, NULL,0,NULL);
@@ -4436,7 +4490,15 @@ RedisModuleBlockedClient *RM_BlockClient(RedisModuleCtx *ctx, RedisModuleCmdFunc
* freed using the free_privdata callback provided by the user.
*
* However the reply callback will be able to access the argument vector of
* the command, so the private data is often not needed. */
* the command, so the private data is often not needed.
*
* Note: Under normal circumstances RedisModule_UnblockClient should not be
* called for clients that are blocked on keys (Either the key will
* become ready or a timeout will occur). If for some reason you do want
* to call RedisModule_UnblockClient it is possible: Client will be
* handled as if it were timed-out (You must implement the timeout
* callback in that case).
*/
RedisModuleBlockedClient *RM_BlockClientOnKeys(RedisModuleCtx *ctx, RedisModuleCmdFunc reply_callback, RedisModuleCmdFunc timeout_callback, void (*free_privdata)(RedisModuleCtx*,void*), long long timeout_ms, RedisModuleString **keys, int numkeys, void *privdata) {
return moduleBlockClient(ctx,reply_callback,timeout_callback,free_privdata,timeout_ms, keys,numkeys,privdata);
}
@@ -4698,9 +4760,9 @@ int RM_BlockedClientDisconnected(RedisModuleCtx *ctx) {
*
* To call non-reply APIs, the thread safe context must be prepared with:
*
* RedisModule_ThreadSafeCallStart(ctx);
* RedisModule_ThreadSafeContextLock(ctx);
* ... make your call here ...
* RedisModule_ThreadSafeCallStop(ctx);
* RedisModule_ThreadSafeContextUnlock(ctx);
*
* This is not needed when using `RedisModule_Reply*` functions, assuming
* that a blocked client was used when the context was created, otherwise
@@ -4783,7 +4845,8 @@ void moduleReleaseGIL(void) {
* - REDISMODULE_NOTIFY_EXPIRED: Expiration events
* - REDISMODULE_NOTIFY_EVICTED: Eviction events
* - REDISMODULE_NOTIFY_STREAM: Stream events
* - REDISMODULE_NOTIFY_ALL: All events
* - REDISMODULE_NOTIFY_KEYMISS: Key-miss events
* - REDISMODULE_NOTIFY_ALL: All events (Excluding REDISMODULE_NOTIFY_KEYMISS)
*
* We do not distinguish between key events and keyspace events, and it is up
* to the module to filter the actions taken based on the key.
@@ -5082,10 +5145,13 @@ int RM_GetClusterNodeInfo(RedisModuleCtx *ctx, const char *id, char *ip, char *m
UNUSED(ctx);
clusterNode *node = clusterLookupNode(id);
if (node->flags & (CLUSTER_NODE_NOADDR|CLUSTER_NODE_HANDSHAKE))
if (node == NULL ||
node->flags & (CLUSTER_NODE_NOADDR|CLUSTER_NODE_HANDSHAKE))
{
return REDISMODULE_ERR;
}
if (ip) memcpy(ip,node->name,REDISMODULE_NODE_ID_LEN);
if (ip) strncpy(ip,node->ip,NET_IP_STR_LEN);
if (master_id) {
/* If the information is not available, the function will set the
@@ -5912,7 +5978,7 @@ sds modulesCollectInfo(sds info, const char *section, int for_crash_report, int
struct RedisModule *module = dictGetVal(de);
if (!module->info_cb)
continue;
RedisModuleInfoCtx info_ctx = {module, section, info, sections, 0};
RedisModuleInfoCtx info_ctx = {module, section, info, sections, 0, 0};
module->info_cb(&info_ctx, for_crash_report);
/* Implicitly end dicts (no way to handle errors, and we must add the newline). */
if (info_ctx.in_dict_field)
@@ -6171,7 +6237,7 @@ int moduleUnregisterUsedAPI(RedisModule *module) {
RedisModule *used = ln->value;
listNode *ln = listSearchKey(used->usedby,module);
if (ln) {
listDelNode(module->using,ln);
listDelNode(used->usedby,ln);
count++;
}
}
@@ -6463,24 +6529,32 @@ void RM_ScanCursorDestroy(RedisModuleScanCursor *cursor) {
zfree(cursor);
}
/* Scan api that allows a module to scan all the keys and value in the selected db.
/* Scan API that allows a module to scan all the keys and value in
* the selected db.
*
* Callback for scan implementation.
* void scan_callback(RedisModuleCtx *ctx, RedisModuleString *keyname, RedisModuleKey *key, void *privdata);
* - ctx - the redis module context provided to for the scan.
* - keyname - owned by the caller and need to be retained if used after this function.
* - key - holds info on the key and value, it is provided as best effort, in some cases it might
* be NULL, in which case the user should (can) use RedisModule_OpenKey (and CloseKey too).
* when it is provided, it is owned by the caller and will be free when the callback returns.
* - privdata - the user data provided to RedisModule_Scan.
* void scan_callback(RedisModuleCtx *ctx, RedisModuleString *keyname,
* RedisModuleKey *key, void *privdata);
* ctx - the redis module context provided to for the scan.
* keyname - owned by the caller and need to be retained if used after this
* function.
*
* key - holds info on the key and value, it is provided as best effort, in
* some cases it might be NULL, in which case the user should (can) use
* RedisModule_OpenKey (and CloseKey too).
* when it is provided, it is owned by the caller and will be free when the
* callback returns.
*
* privdata - the user data provided to RedisModule_Scan.
*
* The way it should be used:
* RedisModuleCursor *c = RedisModule_ScanCursorCreate();
* while(RedisModule_Scan(ctx, c, callback, privateData));
* RedisModule_ScanCursorDestroy(c);
*
* It is also possible to use this API from another thread while the lock is acquired durring
* the actuall call to RM_Scan:
* It is also possible to use this API from another thread while the lock
* is acquired durring the actuall call to RM_Scan:
*
* RedisModuleCursor *c = RedisModule_ScanCursorCreate();
* RedisModule_ThreadSafeContextLock(ctx);
* while(RedisModule_Scan(ctx, c, callback, privateData)){
@@ -6490,9 +6564,26 @@ void RM_ScanCursorDestroy(RedisModuleScanCursor *cursor) {
* }
* RedisModule_ScanCursorDestroy(c);
*
* The function will return 1 if there are more elements to scan and 0 otherwise,
* possibly setting errno if the call failed.
* It is also possible to restart and existing cursor using RM_CursorRestart. */
* The function will return 1 if there are more elements to scan and
* 0 otherwise, possibly setting errno if the call failed.
*
* It is also possible to restart and existing cursor using RM_CursorRestart.
*
* IMPORTANT: This API is very similar to the Redis SCAN command from the
* point of view of the guarantees it provides. This means that the API
* may report duplicated keys, but guarantees to report at least one time
* every key that was there from the start to the end of the scanning process.
*
* NOTE: If you do database changes within the callback, you should be aware
* that the internal state of the database may change. For instance it is safe
* to delete or modify the current key, but may not be safe to delete any
* other key.
* Moreover playing with the Redis keyspace while iterating may have the
* effect of returning more duplicates. A safe pattern is to store the keys
* names you want to modify elsewhere, and perform the actions on the keys
* later when the iteration is complete. Howerver this can cost a lot of
* memory, so it may make sense to just operate on the current key when
* possible during the iteration, given that this is safe. */
int RM_Scan(RedisModuleCtx *ctx, RedisModuleScanCursor *cursor, RedisModuleScanCB fn, void *privdata) {
if (cursor->done) {
errno = ENOENT;
@@ -6570,9 +6661,17 @@ static void moduleScanKeyCallback(void *privdata, const dictEntry *de) {
* RedisModule_CloseKey(key);
* RedisModule_ScanCursorDestroy(c);
*
* The function will return 1 if there are more elements to scan and 0 otherwise,
* possibly setting errno if the call failed.
* It is also possible to restart and existing cursor using RM_CursorRestart. */
* The function will return 1 if there are more elements to scan and 0 otherwise,
* possibly setting errno if the call failed.
* It is also possible to restart and existing cursor using RM_CursorRestart.
*
* NOTE: Certain operations are unsafe while iterating the object. For instance
* while the API guarantees to return at least one time all the elements that
* are present in the data structure consistently from the start to the end
* of the iteration (see HSCAN and similar commands documentation), the more
* you play with the elements, the more duplicates you may get. In general
* deleting the current element of the data structure is safe, while removing
* the key you are iterating is not safe. */
int RM_ScanKey(RedisModuleKey *key, RedisModuleScanCursor *cursor, RedisModuleScanKeyCB fn, void *privdata) {
if (key == NULL || key->value == NULL) {
errno = EINVAL;
@@ -6678,7 +6777,7 @@ int RM_Fork(RedisModuleForkDoneHandler cb, void *user_data) {
server.module_child_pid = childpid;
moduleForkInfo.done_handler = cb;
moduleForkInfo.done_handler_user_data = user_data;
serverLog(LL_NOTICE, "Module fork started pid: %d ", childpid);
serverLog(LL_VERBOSE, "Module fork started pid: %d ", childpid);
}
return childpid;
}
@@ -6701,7 +6800,7 @@ int TerminateModuleForkChild(int child_pid, int wait) {
server.module_child_pid != child_pid) return C_ERR;
int statloc;
serverLog(LL_NOTICE,"Killing running module fork child: %ld",
serverLog(LL_VERBOSE,"Killing running module fork child: %ld",
(long) server.module_child_pid);
if (kill(server.module_child_pid,SIGUSR1) != -1 && wait) {
while(wait4(server.module_child_pid,&statloc,0,NULL) !=
@@ -7638,6 +7737,7 @@ void moduleRegisterCoreAPI(void) {
REGISTER_API(CreateStringFromCallReply);
REGISTER_API(CreateString);
REGISTER_API(CreateStringFromLongLong);
REGISTER_API(CreateStringFromDouble);
REGISTER_API(CreateStringFromLongDouble);
REGISTER_API(CreateStringFromString);
REGISTER_API(CreateStringPrintf);
+3 -1
View File
@@ -177,8 +177,10 @@ void execCommand(client *c) {
must_propagate = 1;
}
int acl_retval = ACLCheckCommandPerm(c);
int acl_keypos;
int acl_retval = ACLCheckCommandPerm(c,&acl_keypos);
if (acl_retval != ACL_OK) {
addACLLogEntry(c,acl_retval,acl_keypos,NULL);
addReplyErrorFormat(c,
"-NOPERM ACLs rules changed between the moment the "
"transaction was accumulated and the EXEC call. "
+237 -56
View File
@@ -36,6 +36,7 @@
static void setProtocolError(const char *errstr, client *c);
int postponeClientRead(client *c);
int ProcessingEventsWhileBlocked = 0; /* See processEventsWhileBlocked(). */
/* Return the size consumed from the allocator, for the specified SDS string,
* including internal fragmentation. This function is used in order to compute
@@ -123,7 +124,8 @@ client *createClient(connection *conn) {
c->ctime = c->lastinteraction = server.unixtime;
/* If the default user does not require authentication, the user is
* directly authenticated. */
c->authenticated = (c->user->flags & USER_FLAG_NOPASS) != 0;
c->authenticated = (c->user->flags & USER_FLAG_NOPASS) &&
!(c->user->flags & USER_FLAG_DISABLED);
c->replstate = REPL_STATE_NONE;
c->repl_put_online_on_ack = 0;
c->reploff = 0;
@@ -154,6 +156,9 @@ client *createClient(connection *conn) {
c->peerid = NULL;
c->client_list_node = NULL;
c->client_tracking_redirection = 0;
c->client_tracking_prefixes = NULL;
c->client_cron_last_memory_usage = 0;
c->client_cron_last_memory_type = CLIENT_TYPE_NORMAL;
c->auth_callback = NULL;
c->auth_callback_privdata = NULL;
c->auth_module = NULL;
@@ -369,13 +374,26 @@ void addReplyErrorLength(client *c, const char *s, size_t len) {
* Where the master must propagate the first change even if the second
* will produce an error. However it is useful to log such events since
* they are rare and may hint at errors in a script or a bug in Redis. */
if (c->flags & (CLIENT_MASTER|CLIENT_SLAVE) && !(c->flags & CLIENT_MONITOR)) {
char* to = c->flags & CLIENT_MASTER? "master": "replica";
char* from = c->flags & CLIENT_MASTER? "replica": "master";
int ctype = getClientType(c);
if (ctype == CLIENT_TYPE_MASTER || ctype == CLIENT_TYPE_SLAVE || c->id == CLIENT_ID_AOF) {
char *to, *from;
if (c->id == CLIENT_ID_AOF) {
to = "AOF-loading-client";
from = "server";
} else if (ctype == CLIENT_TYPE_MASTER) {
to = "master";
from = "replica";
} else {
to = "replica";
from = "master";
}
char *cmdname = c->lastcmd ? c->lastcmd->name : "<unknown>";
serverLog(LL_WARNING,"== CRITICAL == This %s is sending an error "
"to its %s: '%s' after processing the command "
"'%s'", from, to, s, cmdname);
server.stat_unexpected_error_replies++;
}
}
@@ -782,7 +800,7 @@ void clientAcceptHandler(connection *conn) {
serverLog(LL_WARNING,
"Error accepting a client connection: %s",
connGetLastError(conn));
freeClient(c);
freeClientAsync(c);
return;
}
@@ -824,7 +842,7 @@ void clientAcceptHandler(connection *conn) {
/* Nothing to do, Just to avoid the warning... */
}
server.stat_rejected_conn++;
freeClient(c);
freeClientAsync(c);
return;
}
}
@@ -883,9 +901,10 @@ static void acceptCommonHandler(connection *conn, int flags, char *ip) {
*/
if (connAccept(conn, clientAcceptHandler) == C_ERR) {
char conninfo[100];
serverLog(LL_WARNING,
"Error accepting a client connection: %s (conn: %s)",
connGetLastError(conn), connGetInfo(conn, conninfo, sizeof(conninfo)));
if (connGetState(conn) == CONN_STATE_ERROR)
serverLog(LL_WARNING,
"Error accepting a client connection: %s (conn: %s)",
connGetLastError(conn), connGetInfo(conn, conninfo, sizeof(conninfo)));
freeClient(connGetPrivateData(conn));
return;
}
@@ -1074,7 +1093,7 @@ void freeClient(client *c) {
}
/* Log link disconnection with slave */
if ((c->flags & CLIENT_SLAVE) && !(c->flags & CLIENT_MONITOR)) {
if (getClientType(c) == CLIENT_TYPE_SLAVE) {
serverLog(LL_WARNING,"Connection with replica %s lost.",
replicationGetSlaveName(c));
}
@@ -1121,7 +1140,7 @@ void freeClient(client *c) {
/* We need to remember the time when we started to have zero
* attached slaves, as after some time we'll free the replication
* backlog. */
if (c->flags & CLIENT_SLAVE && listLength(server.slaves) == 0)
if (getClientType(c) == CLIENT_TYPE_SLAVE && listLength(server.slaves) == 0)
server.repl_no_slaves_since = server.unixtime;
refreshGoodSlavesCount();
/* Fire the replica change modules event. */
@@ -1143,6 +1162,11 @@ void freeClient(client *c) {
listDelNode(server.clients_to_close,ln);
}
/* Remove the contribution that this client gave to our
* incrementally computed memory usage. */
server.stat_clients_type_memory[c->client_cron_last_memory_type] -=
c->client_cron_last_memory_usage;
/* Release other dynamically allocated client structure fields,
* and finally release the client structure itself. */
if (c->name) decrRefCount(c->name);
@@ -1162,9 +1186,14 @@ void freeClientAsync(client *c) {
* may access the list while Redis uses I/O threads. All the other accesses
* are in the context of the main thread while the other threads are
* idle. */
static pthread_mutex_t async_free_queue_mutex = PTHREAD_MUTEX_INITIALIZER;
if (c->flags & CLIENT_CLOSE_ASAP || c->flags & CLIENT_LUA) return;
c->flags |= CLIENT_CLOSE_ASAP;
if (server.io_threads_num == 1) {
/* no need to bother with locking if there's just one thread (the main thread) */
listAddNodeTail(server.clients_to_close,c);
return;
}
static pthread_mutex_t async_free_queue_mutex = PTHREAD_MUTEX_INITIALIZER;
pthread_mutex_lock(&async_free_queue_mutex);
listAddNodeTail(server.clients_to_close,c);
pthread_mutex_unlock(&async_free_queue_mutex);
@@ -1252,8 +1281,8 @@ int writeToClient(client *c, int handler_installed) {
* just deliver as much data as it is possible to deliver.
*
* Moreover, we also send as much as possible if the client is
* a slave (otherwise, on high-speed traffic, the replication
* buffer will grow indefinitely) */
* a slave or a monitor (otherwise, on high-speed traffic, the
* replication/output buffer will grow indefinitely) */
if (totwritten > NET_MAX_WRITES_PER_EVENT &&
(server.maxmemory == 0 ||
zmalloc_used_memory() < server.maxmemory) &&
@@ -1358,6 +1387,12 @@ void resetClient(client *c) {
if (!(c->flags & CLIENT_MULTI) && prevcmd != askingCommand)
c->flags &= ~CLIENT_ASKING;
/* We do the same for the CACHING command as well. It also affects
* the next command or transaction executed, in a way very similar
* to ASKING. */
if (!(c->flags & CLIENT_MULTI) && prevcmd != clientCommand)
c->flags &= ~CLIENT_TRACKING_CACHING;
/* Remove the CLIENT_REPLY_SKIP flag if any so that the reply
* to the next command will be sent, but set the flag if the command
* we just processed was "CLIENT REPLY SKIP". */
@@ -1439,7 +1474,7 @@ int processInlineBuffer(client *c) {
/* Newline from slaves can be used to refresh the last ACK time.
* This is useful for a slave to ping back while loading a big
* RDB file. */
if (querylen == 0 && c->flags & CLIENT_SLAVE)
if (querylen == 0 && getClientType(c) == CLIENT_TYPE_SLAVE)
c->repl_ack_time = server.unixtime;
/* Move querybuffer position to the next query in the buffer. */
@@ -1453,12 +1488,8 @@ int processInlineBuffer(client *c) {
/* Create redis objects for all arguments. */
for (c->argc = 0, j = 0; j < argc; j++) {
if (sdslen(argv[j])) {
c->argv[c->argc] = createObject(OBJ_STRING,argv[j]);
c->argc++;
} else {
sdsfree(argv[j]);
}
c->argv[c->argc] = createObject(OBJ_STRING,argv[j]);
c->argc++;
}
zfree(argv);
return C_OK;
@@ -2002,7 +2033,6 @@ int clientSetNameOrReply(client *c, robj *name) {
if (len == 0) {
if (c->name) decrRefCount(c->name);
c->name = NULL;
addReply(c,shared.ok);
return C_OK;
}
@@ -2026,7 +2056,6 @@ int clientSetNameOrReply(client *c, robj *name) {
void clientCommand(client *c) {
listNode *ln;
listIter li;
client *client;
if (c->argc == 2 && !strcasecmp(c->argv[1]->ptr,"help")) {
const char *help[] = {
@@ -2043,7 +2072,7 @@ void clientCommand(client *c) {
"REPLY (on|off|skip) -- Control the replies sent to the current connection.",
"SETNAME <name> -- Assign the name <name> to the current connection.",
"UNBLOCK <clientid> [TIMEOUT|ERROR] -- Unblock the specified blocked client.",
"TRACKING (on|off) [REDIRECT <id>] -- Enable client keys tracking for client side caching.",
"TRACKING (on|off) [REDIRECT <id>] [BCAST] [PREFIX first] [PREFIX second] [OPTIN] [OPTOUT]... -- Enable client keys tracking for client side caching.",
"GETREDIR -- Return the client ID we are redirecting to when tracking is enabled.",
NULL
};
@@ -2140,7 +2169,7 @@ NULL
/* Iterate clients killing all the matching clients. */
listRewind(server.clients,&li);
while ((ln = listNext(&li)) != NULL) {
client = listNodeValue(ln);
client *client = listNodeValue(ln);
if (addr && strcmp(getClientPeerId(client),addr) != 0) continue;
if (type != -1 && getClientType(client) != type) continue;
if (id != 0 && client->id != id) continue;
@@ -2218,38 +2247,150 @@ NULL
UNIT_MILLISECONDS) != C_OK) return;
pauseClients(duration);
addReply(c,shared.ok);
} else if (!strcasecmp(c->argv[1]->ptr,"tracking") &&
(c->argc == 3 || c->argc == 5))
{
/* CLIENT TRACKING (on|off) [REDIRECT <id>] */
} else if (!strcasecmp(c->argv[1]->ptr,"tracking") && c->argc >= 3) {
/* CLIENT TRACKING (on|off) [REDIRECT <id>] [BCAST] [PREFIX first]
* [PREFIX second] [OPTIN] [OPTOUT] ... */
long long redir = 0;
uint64_t options = 0;
robj **prefix = NULL;
size_t numprefix = 0;
/* Parse the redirection option: we'll require the client with
* the specified ID to exist right now, even if it is possible
* it will get disconnected later. */
if (c->argc == 5) {
if (strcasecmp(c->argv[3]->ptr,"redirect") != 0) {
addReply(c,shared.syntaxerr);
return;
} else {
if (getLongLongFromObjectOrReply(c,c->argv[4],&redir,NULL) !=
C_OK) return;
/* Parse the options. */
for (int j = 3; j < c->argc; j++) {
int moreargs = (c->argc-1) - j;
if (!strcasecmp(c->argv[j]->ptr,"redirect") && moreargs) {
j++;
if (redir != 0) {
addReplyError(c,"A client can only redirect to a single "
"other client");
zfree(prefix);
return;
}
if (getLongLongFromObjectOrReply(c,c->argv[j],&redir,NULL) !=
C_OK)
{
zfree(prefix);
return;
}
/* We will require the client with the specified ID to exist
* right now, even if it is possible that it gets disconnected
* later. Still a valid sanity check. */
if (lookupClientByID(redir) == NULL) {
addReplyError(c,"The client ID you want redirect to "
"does not exist");
zfree(prefix);
return;
}
} else if (!strcasecmp(c->argv[j]->ptr,"bcast")) {
options |= CLIENT_TRACKING_BCAST;
} else if (!strcasecmp(c->argv[j]->ptr,"optin")) {
options |= CLIENT_TRACKING_OPTIN;
} else if (!strcasecmp(c->argv[j]->ptr,"optout")) {
options |= CLIENT_TRACKING_OPTOUT;
} else if (!strcasecmp(c->argv[j]->ptr,"prefix") && moreargs) {
j++;
prefix = zrealloc(prefix,sizeof(robj*)*(numprefix+1));
prefix[numprefix++] = c->argv[j];
} else {
zfree(prefix);
addReply(c,shared.syntaxerr);
return;
}
}
/* Options are ok: enable or disable the tracking for this client. */
if (!strcasecmp(c->argv[2]->ptr,"on")) {
enableTracking(c,redir);
/* Before enabling tracking, make sure options are compatible
* among each other and with the current state of the client. */
if (!(options & CLIENT_TRACKING_BCAST) && numprefix) {
addReplyError(c,
"PREFIX option requires BCAST mode to be enabled");
zfree(prefix);
return;
}
if (c->flags & CLIENT_TRACKING) {
int oldbcast = !!(c->flags & CLIENT_TRACKING_BCAST);
int newbcast = !!(options & CLIENT_TRACKING_BCAST);
if (oldbcast != newbcast) {
addReplyError(c,
"You can't switch BCAST mode on/off before disabling "
"tracking for this client, and then re-enabling it with "
"a different mode.");
zfree(prefix);
return;
}
}
if (options & CLIENT_TRACKING_BCAST &&
options & (CLIENT_TRACKING_OPTIN|CLIENT_TRACKING_OPTOUT))
{
addReplyError(c,
"OPTIN and OPTOUT are not compatible with BCAST");
zfree(prefix);
return;
}
if (options & CLIENT_TRACKING_OPTIN && options & CLIENT_TRACKING_OPTOUT)
{
addReplyError(c,
"You can't specify both OPTIN mode and OPTOUT mode");
zfree(prefix);
return;
}
if ((options & CLIENT_TRACKING_OPTIN && c->flags & CLIENT_TRACKING_OPTOUT) ||
(options & CLIENT_TRACKING_OPTOUT && c->flags & CLIENT_TRACKING_OPTIN))
{
addReplyError(c,
"You can't switch OPTIN/OPTOUT mode before disabling "
"tracking for this client, and then re-enabling it with "
"a different mode.");
zfree(prefix);
return;
}
enableTracking(c,redir,options,prefix,numprefix);
} else if (!strcasecmp(c->argv[2]->ptr,"off")) {
disableTracking(c);
} else {
zfree(prefix);
addReply(c,shared.syntaxerr);
return;
}
zfree(prefix);
addReply(c,shared.ok);
} else if (!strcasecmp(c->argv[1]->ptr,"caching") && c->argc >= 3) {
if (!(c->flags & CLIENT_TRACKING)) {
addReplyError(c,"CLIENT CACHING can be called only when the "
"client is in tracking mode with OPTIN or "
"OPTOUT mode enabled");
return;
}
char *opt = c->argv[2]->ptr;
if (!strcasecmp(opt,"yes")) {
if (c->flags & CLIENT_TRACKING_OPTIN) {
c->flags |= CLIENT_TRACKING_CACHING;
} else {
addReplyError(c,"CLIENT CACHING YES is only valid when tracking is enabled in OPTIN mode.");
return;
}
} else if (!strcasecmp(opt,"no")) {
if (c->flags & CLIENT_TRACKING_OPTOUT) {
c->flags |= CLIENT_TRACKING_CACHING;
} else {
addReplyError(c,"CLIENT CACHING NO is only valid when tracking is enabled in OPTOUT mode.");
return;
}
} else {
addReply(c,shared.syntaxerr);
return;
}
/* Common reply for when we succeeded. */
addReply(c,shared.ok);
} else if (!strcasecmp(c->argv[1]->ptr,"getredir") && c->argc == 2) {
/* CLIENT GETREDIR */
@@ -2438,12 +2579,14 @@ unsigned long getClientOutputBufferMemoryUsage(client *c) {
*
* The function will return one of the following:
* CLIENT_TYPE_NORMAL -> Normal client
* CLIENT_TYPE_SLAVE -> Slave or client executing MONITOR command
* CLIENT_TYPE_SLAVE -> Slave
* CLIENT_TYPE_PUBSUB -> Client subscribed to Pub/Sub channels
* CLIENT_TYPE_MASTER -> The client representing our replication master.
*/
int getClientType(client *c) {
if (c->flags & CLIENT_MASTER) return CLIENT_TYPE_MASTER;
/* Even though MONITOR clients are marked as replicas, we
* want the expose them as normal clients. */
if ((c->flags & CLIENT_SLAVE) && !(c->flags & CLIENT_MONITOR))
return CLIENT_TYPE_SLAVE;
if (c->flags & CLIENT_PUBSUB) return CLIENT_TYPE_PUBSUB;
@@ -2636,6 +2779,12 @@ int clientsArePaused(void) {
int processEventsWhileBlocked(void) {
int iterations = 4; /* See the function top-comment. */
int count = 0;
/* Note: when we are processing events while blocked (for instance during
* busy Lua scripts), we set a global flag. When such flag is set, we
* avoid handling the read part of clients using threaded I/O.
* See https://github.com/antirez/redis/issues/6988 for more info. */
ProcessingEventsWhileBlocked = 1;
while (iterations--) {
int events = 0;
events += aeProcessEvents(server.el, AE_FILE_EVENTS|AE_DONT_WAIT);
@@ -2643,6 +2792,7 @@ int processEventsWhileBlocked(void) {
if (!events) break;
count += events;
}
ProcessingEventsWhileBlocked = 0;
return count;
}
@@ -2661,6 +2811,10 @@ pthread_mutex_t io_threads_mutex[IO_THREADS_MAX_NUM];
_Atomic unsigned long io_threads_pending[IO_THREADS_MAX_NUM];
int io_threads_active; /* Are the threads currently spinning waiting I/O? */
int io_threads_op; /* IO_THREADS_OP_WRITE or IO_THREADS_OP_READ. */
/* This is the list of clients each thread will serve when threaded I/O is
* used. We spawn io_threads_num-1 threads, since one is the main thread
* itself. */
list *io_threads_list[IO_THREADS_MAX_NUM];
void *IOThreadMain(void *myid) {
@@ -2721,12 +2875,16 @@ void initThreadedIO(void) {
exit(1);
}
/* Spawn the I/O threads. */
/* Spawn and initialize the I/O threads. */
for (int i = 0; i < server.io_threads_num; i++) {
/* Things we do for all the threads including the main thread. */
io_threads_list[i] = listCreate();
if (i == 0) continue; /* Thread 0 is the main thread. */
/* Things we do only for the additional threads. */
pthread_t tid;
pthread_mutex_init(&io_threads_mutex[i],NULL);
io_threads_pending[i] = 0;
io_threads_list[i] = listCreate();
pthread_mutex_lock(&io_threads_mutex[i]); /* Thread will be stopped. */
if (pthread_create(&tid,NULL,IOThreadMain,(void*)(long)i) != 0) {
serverLog(LL_WARNING,"Fatal: Can't initialize IO thread.");
@@ -2740,7 +2898,7 @@ void startThreadedIO(void) {
if (tio_debug) { printf("S"); fflush(stdout); }
if (tio_debug) printf("--- STARTING THREADED IO ---\n");
serverAssert(io_threads_active == 0);
for (int j = 0; j < server.io_threads_num; j++)
for (int j = 1; j < server.io_threads_num; j++)
pthread_mutex_unlock(&io_threads_mutex[j]);
io_threads_active = 1;
}
@@ -2754,7 +2912,7 @@ void stopThreadedIO(void) {
(int) listLength(server.clients_pending_read),
(int) listLength(server.clients_pending_write));
serverAssert(io_threads_active == 1);
for (int j = 0; j < server.io_threads_num; j++)
for (int j = 1; j < server.io_threads_num; j++)
pthread_mutex_lock(&io_threads_mutex[j]);
io_threads_active = 0;
}
@@ -2813,15 +2971,23 @@ int handleClientsWithPendingWritesUsingThreads(void) {
/* Give the start condition to the waiting threads, by setting the
* start condition atomic var. */
io_threads_op = IO_THREADS_OP_WRITE;
for (int j = 0; j < server.io_threads_num; j++) {
for (int j = 1; j < server.io_threads_num; j++) {
int count = listLength(io_threads_list[j]);
io_threads_pending[j] = count;
}
/* Wait for all threads to end their work. */
/* Also use the main thread to process a slice of clients. */
listRewind(io_threads_list[0],&li);
while((ln = listNext(&li))) {
client *c = listNodeValue(ln);
writeToClient(c,0);
}
listEmpty(io_threads_list[0]);
/* Wait for all the other threads to end their work. */
while(1) {
unsigned long pending = 0;
for (int j = 0; j < server.io_threads_num; j++)
for (int j = 1; j < server.io_threads_num; j++)
pending += io_threads_pending[j];
if (pending == 0) break;
}
@@ -2852,6 +3018,7 @@ int handleClientsWithPendingWritesUsingThreads(void) {
int postponeClientRead(client *c) {
if (io_threads_active &&
server.io_threads_do_reads &&
!ProcessingEventsWhileBlocked &&
!(c->flags & (CLIENT_MASTER|CLIENT_SLAVE|CLIENT_PENDING_READ)))
{
c->flags |= CLIENT_PENDING_READ;
@@ -2890,31 +3057,45 @@ int handleClientsWithPendingReadsUsingThreads(void) {
/* Give the start condition to the waiting threads, by setting the
* start condition atomic var. */
io_threads_op = IO_THREADS_OP_READ;
for (int j = 0; j < server.io_threads_num; j++) {
for (int j = 1; j < server.io_threads_num; j++) {
int count = listLength(io_threads_list[j]);
io_threads_pending[j] = count;
}
/* Wait for all threads to end their work. */
/* Also use the main thread to process a slice of clients. */
listRewind(io_threads_list[0],&li);
while((ln = listNext(&li))) {
client *c = listNodeValue(ln);
readQueryFromClient(c->conn);
}
listEmpty(io_threads_list[0]);
/* Wait for all the other threads to end their work. */
while(1) {
unsigned long pending = 0;
for (int j = 0; j < server.io_threads_num; j++)
for (int j = 1; j < server.io_threads_num; j++)
pending += io_threads_pending[j];
if (pending == 0) break;
}
if (tio_debug) printf("I/O READ All threads finshed\n");
/* Run the list of clients again to process the new buffers. */
listRewind(server.clients_pending_read,&li);
while((ln = listNext(&li))) {
while(listLength(server.clients_pending_read)) {
ln = listFirst(server.clients_pending_read);
client *c = listNodeValue(ln);
c->flags &= ~CLIENT_PENDING_READ;
listDelNode(server.clients_pending_read,ln);
if (c->flags & CLIENT_PENDING_COMMAND) {
c->flags &= ~ CLIENT_PENDING_COMMAND;
processCommandAndResetClient(c);
c->flags &= ~CLIENT_PENDING_COMMAND;
if (processCommandAndResetClient(c) == C_ERR) {
/* If the client is no longer valid, we avoid
* processing the client later. So we just go
* to the next. */
continue;
}
}
processInputBufferAndReplicate(c);
}
listEmpty(server.clients_pending_read);
return processed;
}
+1 -1
View File
@@ -82,10 +82,10 @@ sds keyspaceEventsFlagsToString(int flags) {
if (flags & NOTIFY_EXPIRED) res = sdscatlen(res,"x",1);
if (flags & NOTIFY_EVICTED) res = sdscatlen(res,"e",1);
if (flags & NOTIFY_STREAM) res = sdscatlen(res,"t",1);
if (flags & NOTIFY_KEY_MISS) res = sdscatlen(res,"m",1);
}
if (flags & NOTIFY_KEYSPACE) res = sdscatlen(res,"K",1);
if (flags & NOTIFY_KEYEVENT) res = sdscatlen(res,"E",1);
if (flags & NOTIFY_KEY_MISS) res = sdscatlen(res,"m",1);
return res;
}
+21 -45
View File
@@ -347,7 +347,15 @@ void freeStreamObject(robj *o) {
}
void incrRefCount(robj *o) {
if (o->refcount != OBJ_SHARED_REFCOUNT) o->refcount++;
if (o->refcount < OBJ_FIRST_SPECIAL_REFCOUNT) {
o->refcount++;
} else {
if (o->refcount == OBJ_SHARED_REFCOUNT) {
/* Nothing to do: this refcount is immutable. */
} else if (o->refcount == OBJ_STATIC_REFCOUNT) {
serverPanic("You tried to retain an object allocated in the stack");
}
}
}
void decrRefCount(robj *o) {
@@ -640,21 +648,13 @@ int getDoubleFromObjectOrReply(client *c, robj *o, double *target, const char *m
int getLongDoubleFromObject(robj *o, long double *target) {
long double value;
char *eptr;
if (o == NULL) {
value = 0;
} else {
serverAssertWithInfo(NULL,o,o->type == OBJ_STRING);
if (sdsEncodedObject(o)) {
errno = 0;
value = strtold(o->ptr, &eptr);
if (sdslen(o->ptr) == 0 ||
isspace(((const char*)o->ptr)[0]) ||
(size_t)(eptr-(char*)o->ptr) != sdslen(o->ptr) ||
(errno == ERANGE &&
(value == HUGE_VAL || value == -HUGE_VAL || value == 0)) ||
isnan(value))
if (!string2ld(o->ptr, sdslen(o->ptr), &value))
return C_ERR;
} else if (o->encoding == OBJ_ENCODING_INT) {
value = (long)o->ptr;
@@ -982,39 +982,15 @@ struct redisMemOverhead *getMemoryOverheadData(void) {
mh->repl_backlog = mem;
mem_total += mem;
mem = 0;
if (listLength(server.slaves)) {
listIter li;
listNode *ln;
listRewind(server.slaves,&li);
while((ln = listNext(&li))) {
client *c = listNodeValue(ln);
mem += getClientOutputBufferMemoryUsage(c);
mem += sdsAllocSize(c->querybuf);
mem += sizeof(client);
}
}
mh->clients_slaves = mem;
mem_total+=mem;
mem = 0;
if (listLength(server.clients)) {
listIter li;
listNode *ln;
listRewind(server.clients,&li);
while((ln = listNext(&li))) {
client *c = listNodeValue(ln);
if (c->flags & CLIENT_SLAVE && !(c->flags & CLIENT_MONITOR))
continue;
mem += getClientOutputBufferMemoryUsage(c);
mem += sdsAllocSize(c->querybuf);
mem += sizeof(client);
}
}
mh->clients_normal = mem;
mem_total+=mem;
/* Computing the memory used by the clients would be O(N) if done
* here online. We use our values computed incrementally by
* clientsCronTrackClientsMemUsage(). */
mh->clients_slaves = server.stat_clients_type_memory[CLIENT_TYPE_SLAVE];
mh->clients_normal = server.stat_clients_type_memory[CLIENT_TYPE_MASTER]+
server.stat_clients_type_memory[CLIENT_TYPE_PUBSUB]+
server.stat_clients_type_memory[CLIENT_TYPE_NORMAL];
mem_total += mh->clients_slaves;
mem_total += mh->clients_normal;
mem = 0;
if (server.aof_state != AOF_OFF) {
@@ -1119,13 +1095,13 @@ sds getMemoryDoctorReport(void) {
num_reports++;
}
/* Allocator fss is higher than 1.1 and 10MB ? */
/* Allocator rss is higher than 1.1 and 10MB ? */
if (mh->allocator_rss > 1.1 && mh->allocator_rss_bytes > 10<<20) {
high_alloc_rss = 1;
num_reports++;
}
/* Non-Allocator fss is higher than 1.1 and 10MB ? */
/* Non-Allocator rss is higher than 1.1 and 10MB ? */
if (mh->rss_extra > 1.1 && mh->rss_extra_bytes > 10<<20) {
high_proc_rss = 1;
num_reports++;
+47 -13
View File
@@ -35,7 +35,11 @@ int clientSubscriptionsCount(client *c);
* Pubsub client replies API
*----------------------------------------------------------------------------*/
/* Send a pubsub message of type "message" to the client. */
/* Send a pubsub message of type "message" to the client.
* Normally 'msg' is a Redis object containing the string to send as
* message. However if the caller sets 'msg' as NULL, it will be able
* to send a special message (for instance an Array type) by using the
* addReply*() API family. */
void addReplyPubsubMessage(client *c, robj *channel, robj *msg) {
if (c->resp == 2)
addReply(c,shared.mbulkhdr[3]);
@@ -43,7 +47,7 @@ void addReplyPubsubMessage(client *c, robj *channel, robj *msg) {
addReplyPushLen(c,3);
addReply(c,shared.messagebulk);
addReplyBulk(c,channel);
addReplyBulk(c,msg);
if (msg) addReplyBulk(c,msg);
}
/* Send a pubsub message of type "pmessage" to the client. The difference
@@ -202,6 +206,8 @@ int pubsubUnsubscribeChannel(client *c, robj *channel, int notify) {
/* Subscribe a client to a pattern. Returns 1 if the operation succeeded, or 0 if the client was already subscribed to that pattern. */
int pubsubSubscribePattern(client *c, robj *pattern) {
dictEntry *de;
list *clients;
int retval = 0;
if (listSearchKey(c->pubsub_patterns,pattern) == NULL) {
@@ -213,6 +219,16 @@ int pubsubSubscribePattern(client *c, robj *pattern) {
pat->pattern = getDecodedObject(pattern);
pat->client = c;
listAddNodeTail(server.pubsub_patterns,pat);
/* Add the client to the pattern -> list of clients hash table */
de = dictFind(server.pubsub_patterns_dict,pattern);
if (de == NULL) {
clients = listCreate();
dictAdd(server.pubsub_patterns_dict,pattern,clients);
incrRefCount(pattern);
} else {
clients = dictGetVal(de);
}
listAddNodeTail(clients,c);
}
/* Notify the client */
addReplyPubsubPatSubscribed(c,pattern);
@@ -222,6 +238,8 @@ int pubsubSubscribePattern(client *c, robj *pattern) {
/* Unsubscribe a client from a channel. Returns 1 if the operation succeeded, or
* 0 if the client was not subscribed to the specified channel. */
int pubsubUnsubscribePattern(client *c, robj *pattern, int notify) {
dictEntry *de;
list *clients;
listNode *ln;
pubsubPattern pat;
int retval = 0;
@@ -234,6 +252,18 @@ int pubsubUnsubscribePattern(client *c, robj *pattern, int notify) {
pat.pattern = pattern;
ln = listSearchKey(server.pubsub_patterns,&pat);
listDelNode(server.pubsub_patterns,ln);
/* Remove the client from the pattern -> clients list hash table */
de = dictFind(server.pubsub_patterns_dict,pattern);
serverAssertWithInfo(c,NULL,de != NULL);
clients = dictGetVal(de);
ln = listSearchKey(clients,c);
serverAssertWithInfo(c,NULL,ln != NULL);
listDelNode(clients,ln);
if (listLength(clients) == 0) {
/* Free the list and associated hash entry at all if this was
* the latest client. */
dictDelete(server.pubsub_patterns_dict,pattern);
}
}
/* Notify the client */
if (notify) addReplyPubsubPatUnsubscribed(c,pattern);
@@ -280,6 +310,7 @@ int pubsubUnsubscribeAllPatterns(client *c, int notify) {
int pubsubPublishMessage(robj *channel, robj *message) {
int receivers = 0;
dictEntry *de;
dictIterator *di;
listNode *ln;
listIter li;
@@ -298,23 +329,26 @@ int pubsubPublishMessage(robj *channel, robj *message) {
}
}
/* Send to clients listening to matching channels */
if (listLength(server.pubsub_patterns)) {
listRewind(server.pubsub_patterns,&li);
di = dictGetIterator(server.pubsub_patterns_dict);
if (di) {
channel = getDecodedObject(channel);
while ((ln = listNext(&li)) != NULL) {
pubsubPattern *pat = ln->value;
if (stringmatchlen((char*)pat->pattern->ptr,
sdslen(pat->pattern->ptr),
while((de = dictNext(di)) != NULL) {
robj *pattern = dictGetKey(de);
list *clients = dictGetVal(de);
if (!stringmatchlen((char*)pattern->ptr,
sdslen(pattern->ptr),
(char*)channel->ptr,
sdslen(channel->ptr),0))
{
addReplyPubsubPatMessage(pat->client,
pat->pattern,channel,message);
sdslen(channel->ptr),0)) continue;
listRewind(clients,&li);
while ((ln = listNext(&li)) != NULL) {
client *c = listNodeValue(ln);
addReplyPubsubPatMessage(c,pattern,channel,message);
receivers++;
}
}
decrRefCount(channel);
dictReleaseIterator(di);
}
return receivers;
}
+148 -2
View File
@@ -70,6 +70,12 @@ static const size_t optimization_level[] = {4096, 8192, 16384, 32768, 65536};
} while (0);
#endif
/* Bookmarks forward declarations */
#define QL_MAX_BM ((1 << QL_BM_BITS)-1)
quicklistBookmark *_quicklistBookmarkFindByName(quicklist *ql, const char *name);
quicklistBookmark *_quicklistBookmarkFindByNode(quicklist *ql, quicklistNode *node);
void _quicklistBookmarkDelete(quicklist *ql, quicklistBookmark *bm);
/* Simple way to give quicklistEntry structs default values with one call. */
#define initEntry(e) \
do { \
@@ -100,10 +106,11 @@ quicklist *quicklistCreate(void) {
quicklist->count = 0;
quicklist->compress = 0;
quicklist->fill = -2;
quicklist->bookmark_count = 0;
return quicklist;
}
#define COMPRESS_MAX (1 << 16)
#define COMPRESS_MAX ((1 << QL_COMP_BITS)-1)
void quicklistSetCompressDepth(quicklist *quicklist, int compress) {
if (compress > COMPRESS_MAX) {
compress = COMPRESS_MAX;
@@ -113,7 +120,7 @@ void quicklistSetCompressDepth(quicklist *quicklist, int compress) {
quicklist->compress = compress;
}
#define FILL_MAX (1 << 15)
#define FILL_MAX ((1 << (QL_FILL_BITS-1))-1)
void quicklistSetFill(quicklist *quicklist, int fill) {
if (fill > FILL_MAX) {
fill = FILL_MAX;
@@ -169,6 +176,7 @@ void quicklistRelease(quicklist *quicklist) {
quicklist->len--;
current = next;
}
quicklistBookmarksClear(quicklist);
zfree(quicklist);
}
@@ -578,6 +586,15 @@ quicklist *quicklistCreateFromZiplist(int fill, int compress,
REDIS_STATIC void __quicklistDelNode(quicklist *quicklist,
quicklistNode *node) {
/* Update the bookmark if any */
quicklistBookmark *bm = _quicklistBookmarkFindByNode(quicklist, node);
if (bm) {
bm->node = node->next;
/* if the bookmark was to the last node, delete it. */
if (!bm->node)
_quicklistBookmarkDelete(quicklist, bm);
}
if (node->next)
node->next->prev = node->prev;
if (node->prev)
@@ -1410,6 +1427,87 @@ void quicklistPush(quicklist *quicklist, void *value, const size_t sz,
}
}
/* Create or update a bookmark in the list which will be updated to the next node
* automatically when the one referenced gets deleted.
* Returns 1 on success (creation of new bookmark or override of an existing one).
* Returns 0 on failure (reached the maximum supported number of bookmarks).
* NOTE: use short simple names, so that string compare on find is quick.
* NOTE: bookmakrk creation may re-allocate the quicklist, so the input pointer
may change and it's the caller responsibilty to update the reference.
*/
int quicklistBookmarkCreate(quicklist **ql_ref, const char *name, quicklistNode *node) {
quicklist *ql = *ql_ref;
if (ql->bookmark_count >= QL_MAX_BM)
return 0;
quicklistBookmark *bm = _quicklistBookmarkFindByName(ql, name);
if (bm) {
bm->node = node;
return 1;
}
ql = zrealloc(ql, sizeof(quicklist) + (ql->bookmark_count+1) * sizeof(quicklistBookmark));
*ql_ref = ql;
ql->bookmarks[ql->bookmark_count].node = node;
ql->bookmarks[ql->bookmark_count].name = zstrdup(name);
ql->bookmark_count++;
return 1;
}
/* Find the quicklist node referenced by a named bookmark.
* When the bookmarked node is deleted the bookmark is updated to the next node,
* and if that's the last node, the bookmark is deleted (so find returns NULL). */
quicklistNode *quicklistBookmarkFind(quicklist *ql, const char *name) {
quicklistBookmark *bm = _quicklistBookmarkFindByName(ql, name);
if (!bm) return NULL;
return bm->node;
}
/* Delete a named bookmark.
* returns 0 if bookmark was not found, and 1 if deleted.
* Note that the bookmark memory is not freed yet, and is kept for future use. */
int quicklistBookmarkDelete(quicklist *ql, const char *name) {
quicklistBookmark *bm = _quicklistBookmarkFindByName(ql, name);
if (!bm)
return 0;
_quicklistBookmarkDelete(ql, bm);
return 1;
}
quicklistBookmark *_quicklistBookmarkFindByName(quicklist *ql, const char *name) {
unsigned i;
for (i=0; i<ql->bookmark_count; i++) {
if (!strcmp(ql->bookmarks[i].name, name)) {
return &ql->bookmarks[i];
}
}
return NULL;
}
quicklistBookmark *_quicklistBookmarkFindByNode(quicklist *ql, quicklistNode *node) {
unsigned i;
for (i=0; i<ql->bookmark_count; i++) {
if (ql->bookmarks[i].node == node) {
return &ql->bookmarks[i];
}
}
return NULL;
}
void _quicklistBookmarkDelete(quicklist *ql, quicklistBookmark *bm) {
int index = bm - ql->bookmarks;
zfree(bm->name);
ql->bookmark_count--;
memmove(bm, bm+1, (ql->bookmark_count - index)* sizeof(*bm));
/* NOTE: We do not shrink (realloc) the quicklist yet (to avoid resonance,
* it may be re-used later (a call to realloc may NOP). */
}
void quicklistBookmarksClear(quicklist *ql) {
while (ql->bookmark_count)
zfree(ql->bookmarks[--ql->bookmark_count].name);
/* NOTE: We do not shrink (realloc) the quick list. main use case for this
* function is just before releasing the allocation. */
}
/* The rest of this file is test cases and test helpers. */
#ifdef REDIS_TEST
#include <stdint.h>
@@ -2641,6 +2739,54 @@ int quicklistTest(int argc, char *argv[]) {
printf("Compressions: %0.2f seconds.\n", (float)(stop - start) / 1000);
printf("\n");
TEST("bookmark get updated to next item") {
quicklist *ql = quicklistNew(1, 0);
quicklistPushTail(ql, "1", 1);
quicklistPushTail(ql, "2", 1);
quicklistPushTail(ql, "3", 1);
quicklistPushTail(ql, "4", 1);
quicklistPushTail(ql, "5", 1);
assert(ql->len==5);
/* add two bookmarks, one pointing to the node before the last. */
assert(quicklistBookmarkCreate(&ql, "_dummy", ql->head->next));
assert(quicklistBookmarkCreate(&ql, "_test", ql->tail->prev));
/* test that the bookmark returns the right node, delete it and see that the bookmark points to the last node */
assert(quicklistBookmarkFind(ql, "_test") == ql->tail->prev);
assert(quicklistDelRange(ql, -2, 1));
assert(quicklistBookmarkFind(ql, "_test") == ql->tail);
/* delete the last node, and see that the bookmark was deleted. */
assert(quicklistDelRange(ql, -1, 1));
assert(quicklistBookmarkFind(ql, "_test") == NULL);
/* test that other bookmarks aren't affected */
assert(quicklistBookmarkFind(ql, "_dummy") == ql->head->next);
assert(quicklistBookmarkFind(ql, "_missing") == NULL);
assert(ql->len==3);
quicklistBookmarksClear(ql); /* for coverage */
assert(quicklistBookmarkFind(ql, "_dummy") == NULL);
quicklistRelease(ql);
}
TEST("bookmark limit") {
int i;
quicklist *ql = quicklistNew(1, 0);
quicklistPushHead(ql, "1", 1);
for (i=0; i<QL_MAX_BM; i++)
assert(quicklistBookmarkCreate(&ql, genstr("",i), ql->head));
/* when all bookmarks are used, creation fails */
assert(!quicklistBookmarkCreate(&ql, "_test", ql->head));
/* delete one and see that we can now create another */
assert(quicklistBookmarkDelete(ql, "0"));
assert(quicklistBookmarkCreate(&ql, "_test", ql->head));
/* delete one and see that the rest survive */
assert(quicklistBookmarkDelete(ql, "_test"));
for (i=1; i<QL_MAX_BM; i++)
assert(quicklistBookmarkFind(ql, genstr("",i)) == ql->head);
/* make sure the deleted ones are indeed gone */
assert(!quicklistBookmarkFind(ql, "0"));
assert(!quicklistBookmarkFind(ql, "_test"));
quicklistRelease(ql);
}
if (!err)
printf("ALL TESTS PASSED!\n");
else
+43 -3
View File
@@ -28,6 +28,8 @@
* POSSIBILITY OF SUCH DAMAGE.
*/
#include <stdint.h> // for UINTPTR_MAX
#ifndef __QUICKLIST_H__
#define __QUICKLIST_H__
@@ -64,19 +66,51 @@ typedef struct quicklistLZF {
char compressed[];
} quicklistLZF;
/* Bookmarks are padded with realloc at the end of of the quicklist struct.
* They should only be used for very big lists if thousands of nodes were the
* excess memory usage is negligible, and there's a real need to iterate on them
* in portions.
* When not used, they don't add any memory overhead, but when used and then
* deleted, some overhead remains (to avoid resonance).
* The number of bookmarks used should be kept to minimum since it also adds
* overhead on node deletion (searching for a bookmark to update). */
typedef struct quicklistBookmark {
quicklistNode *node;
char *name;
} quicklistBookmark;
#if UINTPTR_MAX == 0xffffffff
/* 32-bit */
# define QL_FILL_BITS 14
# define QL_COMP_BITS 14
# define QL_BM_BITS 4
#elif UINTPTR_MAX == 0xffffffffffffffff
/* 64-bit */
# define QL_FILL_BITS 16
# define QL_COMP_BITS 16
# define QL_BM_BITS 4 /* we can encode more, but we rather limit the user
since they cause performance degradation. */
#else
# error unknown arch bits count
#endif
/* quicklist is a 40 byte struct (on 64-bit systems) describing a quicklist.
* 'count' is the number of total entries.
* 'len' is the number of quicklist nodes.
* 'compress' is: -1 if compression disabled, otherwise it's the number
* of quicklistNodes to leave uncompressed at ends of quicklist.
* 'fill' is the user-requested (or default) fill factor. */
* 'fill' is the user-requested (or default) fill factor.
* 'bookmakrs are an optional feature that is used by realloc this struct,
* so that they don't consume memory when not used. */
typedef struct quicklist {
quicklistNode *head;
quicklistNode *tail;
unsigned long count; /* total count of all entries in all ziplists */
unsigned long len; /* number of quicklistNodes */
int fill : 16; /* fill factor for individual nodes */
unsigned int compress : 16; /* depth of end nodes not to compress;0=off */
int fill : QL_FILL_BITS; /* fill factor for individual nodes */
unsigned int compress : QL_COMP_BITS; /* depth of end nodes not to compress;0=off */
unsigned int bookmark_count: QL_BM_BITS;
quicklistBookmark bookmarks[];
} quicklist;
typedef struct quicklistIter {
@@ -158,6 +192,12 @@ unsigned long quicklistCount(const quicklist *ql);
int quicklistCompare(unsigned char *p1, unsigned char *p2, int p2_len);
size_t quicklistGetLzf(const quicklistNode *node, void **data);
/* bookmarks */
int quicklistBookmarkCreate(quicklist **ql_ref, const char *name, quicklistNode *node);
int quicklistBookmarkDelete(quicklist *ql, const char *name);
quicklistNode *quicklistBookmarkFind(quicklist *ql, const char *name);
void quicklistBookmarksClear(quicklist *ql);
#ifdef REDIS_TEST
int quicklistTest(int argc, char *argv[]);
#endif
+1
View File
@@ -1766,6 +1766,7 @@ int raxRandomWalk(raxIterator *it, size_t steps) {
if (n->iskey) steps--;
}
it->node = n;
it->data = raxGetData(it->node);
return 1;
}
+51 -24
View File
@@ -1002,8 +1002,8 @@ ssize_t rdbSaveObject(rio *rdb, robj *o, robj *key) {
* the rdbSaveObject() function. Currently we use a trick to get
* this length with very little changes to the code. In the future
* we could switch to a faster solution. */
size_t rdbSavedObjectLen(robj *o) {
ssize_t len = rdbSaveObject(NULL,o,NULL);
size_t rdbSavedObjectLen(robj *o, robj *key) {
ssize_t len = rdbSaveObject(NULL,o,key);
serverAssertWithInfo(NULL,o,len != -1);
return len;
}
@@ -1175,10 +1175,7 @@ int rdbSaveRio(rio *rdb, int *error, int rdbflags, rdbSaveInfo *rsi) {
if (rdbSaveType(rdb,RDB_OPCODE_SELECTDB) == -1) goto werr;
if (rdbSaveLen(rdb,j) == -1) goto werr;
/* Write the RESIZE DB opcode. We trim the size to UINT32_MAX, which
* is currently the largest type we are able to represent in RDB sizes.
* However this does not limit the actual size of the DB to load since
* these sizes are just hints to resize the hash tables. */
/* Write the RESIZE DB opcode. */
uint64_t db_size, expires_size;
db_size = dictSize(db->dict);
expires_size = dictSize(db->expires);
@@ -1425,7 +1422,7 @@ robj *rdbLoadCheckModuleValue(rio *rdb, char *modulename) {
/* Load a Redis object of the specified type from the specified file.
* On success a newly allocated object is returned, otherwise NULL. */
robj *rdbLoadObject(int rdbtype, rio *rdb, robj *key) {
robj *rdbLoadObject(int rdbtype, rio *rdb, sds key) {
robj *o = NULL, *ele, *dec;
uint64_t len;
unsigned int i;
@@ -1871,7 +1868,10 @@ robj *rdbLoadObject(int rdbtype, rio *rdb, robj *key) {
}
} else if (rdbtype == RDB_TYPE_MODULE || rdbtype == RDB_TYPE_MODULE_2) {
uint64_t moduleid = rdbLoadLen(rdb,NULL);
if (rioGetReadError(rdb)) return NULL;
if (rioGetReadError(rdb)) {
rdbReportReadError("Short read module id");
return NULL;
}
moduleType *mt = moduleTypeLookupModuleByID(moduleid);
char name[10];
@@ -1886,7 +1886,9 @@ robj *rdbLoadObject(int rdbtype, rio *rdb, robj *key) {
exit(1);
}
RedisModuleIO io;
moduleInitIOContext(io,mt,rdb,key);
robj keyobj;
initStaticStringObject(keyobj,key);
moduleInitIOContext(io,mt,rdb,&keyobj);
io.ver = (rdbtype == RDB_TYPE_MODULE) ? 1 : 2;
/* Call the rdb_load method of the module providing the 10 bit
* encoding version in the lower 10 bits of the module ID. */
@@ -2044,7 +2046,8 @@ int rdbLoadRio(rio *rdb, int rdbflags, rdbSaveInfo *rsi) {
long long lru_clock = LRU_CLOCK();
while(1) {
robj *key, *val;
sds key;
robj *val;
/* Read type. */
if ((type = rdbLoadType(rdb)) == -1) goto eoferr;
@@ -2192,7 +2195,7 @@ int rdbLoadRio(rio *rdb, int rdbflags, rdbSaveInfo *rsi) {
io.ver = 2;
/* Call the rdb_load method of the module providing the 10 bit
* encoding version in the lower 10 bits of the module ID. */
if (mt->aux_load(&io,moduleid&1023, when) || io.error) {
if (mt->aux_load(&io,moduleid&1023, when) != REDISMODULE_OK || io.error) {
moduleTypeNameByID(name,moduleid);
serverLog(LL_WARNING,"The RDB file contains module AUX data for the module type '%s', that the responsible module is not able to load. Check for modules log above for additional clues.", name);
exit(1);
@@ -2216,10 +2219,11 @@ int rdbLoadRio(rio *rdb, int rdbflags, rdbSaveInfo *rsi) {
}
/* Read key */
if ((key = rdbLoadStringObject(rdb)) == NULL) goto eoferr;
if ((key = rdbGenericLoadStringObject(rdb,RDB_LOAD_SDS,NULL)) == NULL)
goto eoferr;
/* Read value */
if ((val = rdbLoadObject(type,rdb,key)) == NULL) {
decrRefCount(key);
sdsfree(key);
goto eoferr;
}
@@ -2227,26 +2231,49 @@ int rdbLoadRio(rio *rdb, int rdbflags, rdbSaveInfo *rsi) {
* an RDB file from disk, either at startup, or when an RDB was
* received from the master. In the latter case, the master is
* responsible for key expiry. If we would expire keys here, the
* snapshot taken by the master may not be reflected on the slave. */
if (server.masterhost == NULL && !(rdbflags&RDBFLAGS_AOF_PREAMBLE) && expiretime != -1 && expiretime < now) {
decrRefCount(key);
* snapshot taken by the master may not be reflected on the slave.
* Similarly if the RDB is the preamble of an AOF file, we want to
* load all the keys as they are, since the log of operations later
* assume to work in an exact keyspace state. */
if (iAmMaster() &&
!(rdbflags&RDBFLAGS_AOF_PREAMBLE) &&
expiretime != -1 && expiretime < now)
{
sdsfree(key);
decrRefCount(val);
} else {
robj keyobj;
/* Add the new object in the hash table */
dbAdd(db,key,val);
int added = dbAddRDBLoad(db,key,val);
if (!added) {
if (rdbflags & RDBFLAGS_ALLOW_DUP) {
/* This flag is useful for DEBUG RELOAD special modes.
* When it's set we allow new keys to replace the current
* keys with the same name. */
initStaticStringObject(keyobj,key);
dbSyncDelete(db,&keyobj);
dbAddRDBLoad(db,key,val);
} else {
serverLog(LL_WARNING,
"RDB has duplicated key '%s' in DB %d",key,db->id);
serverPanic("Duplicated key found in RDB file");
}
}
/* Set the expire time if needed */
if (expiretime != -1) setExpire(NULL,db,key,expiretime);
if (expiretime != -1) {
initStaticStringObject(keyobj,key);
setExpire(NULL,db,&keyobj,expiretime);
}
/* Set usage information (for eviction). */
objectSetLRUOrLFU(val,lfu_freq,lru_idle,lru_clock,1000);
/* Decrement the key refcount since dbAdd() will take its
* own reference. */
decrRefCount(key);
}
if (server.key_load_delay)
usleep(server.key_load_delay);
/* Loading the database more slowly is useful in order to test
* certain edge cases. */
if (server.key_load_delay) usleep(server.key_load_delay);
/* Reset the state that is key-specified and is populated by
* opcodes before the key, so that we start from scratch again. */
+6 -5
View File
@@ -122,9 +122,10 @@
#define RDB_LOAD_SDS (1<<2)
/* flags on the purpose of rdb save or load */
#define RDBFLAGS_NONE 0
#define RDBFLAGS_AOF_PREAMBLE (1<<0)
#define RDBFLAGS_REPLICATION (1<<1)
#define RDBFLAGS_NONE 0 /* No special RDB loading. */
#define RDBFLAGS_AOF_PREAMBLE (1<<0) /* Load/save the RDB as AOF preamble. */
#define RDBFLAGS_REPLICATION (1<<1) /* Load/save for SYNC. */
#define RDBFLAGS_ALLOW_DUP (1<<2) /* Allow duplicated keys when loading.*/
int rdbSaveType(rio *rdb, unsigned char type);
int rdbLoadType(rio *rdb);
@@ -143,8 +144,8 @@ int rdbSaveToSlavesSockets(rdbSaveInfo *rsi);
void rdbRemoveTempFile(pid_t childpid);
int rdbSave(char *filename, rdbSaveInfo *rsi);
ssize_t rdbSaveObject(rio *rdb, robj *o, robj *key);
size_t rdbSavedObjectLen(robj *o);
robj *rdbLoadObject(int type, rio *rdb, robj *key);
size_t rdbSavedObjectLen(robj *o, robj *key);
robj *rdbLoadObject(int type, rio *rdb, sds key);
void backgroundSaveDoneHandler(int exitcode, int bysignal);
int rdbSaveKeyValuePair(rio *rdb, robj *key, robj *val, long long expiretime);
ssize_t rdbSaveSingleModuleAux(rio *rdb, int when, moduleType *mt);
+1 -1
View File
@@ -287,7 +287,7 @@ int redis_check_rdb(char *rdbfilename, FILE *fp) {
rdbstate.keys++;
/* Read value */
rdbstate.doing = RDB_CHECK_DOING_READ_OBJECT_VALUE;
if ((val = rdbLoadObject(type,&rdb,key)) == NULL) goto eoferr;
if ((val = rdbLoadObject(type,&rdb,key->ptr)) == NULL) goto eoferr;
/* Check if the key already expired. */
if (expiretime != -1 && expiretime < now)
rdbstate.already_expired++;
+48 -13
View File
@@ -49,6 +49,7 @@
#include <hiredis.h>
#ifdef USE_OPENSSL
#include <openssl/ssl.h>
#include <openssl/err.h>
#include <hiredis_ssl.h>
#endif
#include <sds.h> /* use sds.h from hiredis, so that only one set of sds functions will be present in the binary */
@@ -228,6 +229,7 @@ static struct config {
int hotkeys;
int stdinarg; /* get last arg from stdin. (-x option) */
char *auth;
int askpass;
char *user;
int output; /* output mode, see OUTPUT_* defines */
sds mb_delim;
@@ -1290,7 +1292,11 @@ static int cliSendCommand(int argc, char **argv, long repeat) {
(argc == 3 && !strcasecmp(command,"latency") &&
!strcasecmp(argv[1],"graph")) ||
(argc == 2 && !strcasecmp(command,"latency") &&
!strcasecmp(argv[1],"doctor")))
!strcasecmp(argv[1],"doctor")) ||
/* Format PROXY INFO command for Redis Cluster Proxy:
* https://github.com/artix75/redis-cluster-proxy */
(argc >= 2 && !strcasecmp(command,"proxy") &&
!strcasecmp(argv[1],"info")))
{
output_raw = 1;
}
@@ -1449,6 +1455,8 @@ static int parseOptions(int argc, char **argv) {
config.dbnum = atoi(argv[++i]);
} else if (!strcmp(argv[i], "--no-auth-warning")) {
config.no_auth_warning = 1;
} else if (!strcmp(argv[i], "--askpass")) {
config.askpass = 1;
} else if ((!strcmp(argv[i],"-a") || !strcmp(argv[i],"--pass"))
&& !lastarg)
{
@@ -1594,15 +1602,15 @@ static int parseOptions(int argc, char **argv) {
#ifdef USE_OPENSSL
} else if (!strcmp(argv[i],"--tls")) {
config.tls = 1;
} else if (!strcmp(argv[i],"--sni")) {
} else if (!strcmp(argv[i],"--sni") && !lastarg) {
config.sni = argv[++i];
} else if (!strcmp(argv[i],"--cacertdir")) {
} else if (!strcmp(argv[i],"--cacertdir") && !lastarg) {
config.cacertdir = argv[++i];
} else if (!strcmp(argv[i],"--cacert")) {
} else if (!strcmp(argv[i],"--cacert") && !lastarg) {
config.cacert = argv[++i];
} else if (!strcmp(argv[i],"--cert")) {
} else if (!strcmp(argv[i],"--cert") && !lastarg) {
config.cert = argv[++i];
} else if (!strcmp(argv[i],"--key")) {
} else if (!strcmp(argv[i],"--key") && !lastarg) {
config.key = argv[++i];
#endif
} else if (!strcmp(argv[i],"-v") || !strcmp(argv[i], "--version")) {
@@ -1687,8 +1695,11 @@ static void usage(void) {
" You can also use the " REDIS_CLI_AUTH_ENV " environment\n"
" variable to pass this password more safely\n"
" (if both are used, this argument takes predecence).\n"
" -user <username> Used to send ACL style 'AUTH username pass'. Needs -a.\n"
" -pass <password> Alias of -a for consistency with the new --user option.\n"
" --user <username> Used to send ACL style 'AUTH username pass'. Needs -a.\n"
" --pass <password> Alias of -a for consistency with the new --user option.\n"
" --askpass Force user to input password with mask from STDIN.\n"
" If this argument is used, '-a' and " REDIS_CLI_AUTH_ENV "\n"
" environment variable will be ignored.\n"
" -u <uri> Server URI.\n"
" -r <repeat> Execute specified command N times.\n"
" -i <interval> When -r is used, waits <interval> seconds per command.\n"
@@ -1700,12 +1711,13 @@ static void usage(void) {
" -c Enable cluster mode (follow -ASK and -MOVED redirections).\n"
#ifdef USE_OPENSSL
" --tls Establish a secure TLS connection.\n"
" --cacert CA Certificate file to verify with.\n"
" --cacertdir Directory where trusted CA certificates are stored.\n"
" --sni <host> Server name indication for TLS.\n"
" --cacert <file> CA Certificate file to verify with.\n"
" --cacertdir <dir> Directory where trusted CA certificates are stored.\n"
" If neither cacert nor cacertdir are specified, the default\n"
" system-wide trusted root certs configuration will apply.\n"
" --cert Client certificate to authenticate with.\n"
" --key Private key file to authenticate with.\n"
" --cert <file> Client certificate to authenticate with.\n"
" --key <file> Private key file to authenticate with.\n"
#endif
" --raw Use raw formatting for replies (default when STDOUT is\n"
" not a tty).\n"
@@ -1981,6 +1993,8 @@ static void repl(void) {
if (config.eval) {
config.eval_ldb = 1;
config.output = OUTPUT_RAW;
sdsfreesplitres(argv,argc);
linenoiseFree(line);
return; /* Return to evalMode to restart the session. */
} else {
printf("Use 'restart' only in Lua debugging mode.");
@@ -7735,7 +7749,7 @@ static void LRUTestMode(void) {
* to fill the target instance easily. */
start_cycle = mstime();
long long hits = 0, misses = 0;
while(mstime() - start_cycle < 1000) {
while(mstime() - start_cycle < LRU_CYCLE_PERIOD) {
/* Write cycle. */
for (j = 0; j < LRU_CYCLE_PIPELINE_SIZE; j++) {
char val[6];
@@ -7856,6 +7870,13 @@ static void intrinsicLatencyMode(void) {
}
}
static sds askPassword() {
linenoiseMaskModeEnable();
sds auth = linenoise("Please input password: ");
linenoiseMaskModeDisable();
return auth;
}
/*------------------------------------------------------------------------------
* Program main()
*--------------------------------------------------------------------------- */
@@ -7892,6 +7913,7 @@ int main(int argc, char **argv) {
config.hotkeys = 0;
config.stdinarg = 0;
config.auth = NULL;
config.askpass = 0;
config.user = NULL;
config.eval = NULL;
config.eval_ldb = 0;
@@ -7933,6 +7955,18 @@ int main(int argc, char **argv) {
parseEnv();
if (config.askpass) {
config.auth = askPassword();
}
#ifdef USE_OPENSSL
if (config.tls) {
ERR_load_crypto_strings();
SSL_load_error_strings();
SSL_library_init();
}
#endif
/* Cluster Manager mode */
if (CLUSTER_MANAGER_MODE()) {
clusterManagerCommandProc *proc = validateClusterManagerCommand();
@@ -8035,3 +8069,4 @@ int main(int argc, char **argv) {
return noninteractive(argc,convertToSds(argc,argv));
}
}
+16 -3
View File
@@ -110,6 +110,8 @@
#define REDISMODULE_CTX_FLAGS_REPLICA_IS_ONLINE (1<<17)
/* There is currently some background process active. */
#define REDISMODULE_CTX_FLAGS_ACTIVE_CHILD (1<<18)
/* The next EXEC will fail due to dirty CAS (touched keys). */
#define REDISMODULE_CTX_FLAGS_MULTI_DIRTY (1<<19)
/* Keyspace changes notification classes. Every class is associated with a
* character for configuration purposes.
@@ -125,8 +127,8 @@
#define REDISMODULE_NOTIFY_EXPIRED (1<<8) /* x */
#define REDISMODULE_NOTIFY_EVICTED (1<<9) /* e */
#define REDISMODULE_NOTIFY_STREAM (1<<10) /* t */
#define REDISMODULE_NOTIFY_KEY_MISS (1<<11) /* m */
#define REDISMODULE_NOTIFY_ALL (REDISMODULE_NOTIFY_GENERIC | REDISMODULE_NOTIFY_STRING | REDISMODULE_NOTIFY_LIST | REDISMODULE_NOTIFY_SET | REDISMODULE_NOTIFY_HASH | REDISMODULE_NOTIFY_ZSET | REDISMODULE_NOTIFY_EXPIRED | REDISMODULE_NOTIFY_EVICTED | REDISMODULE_NOTIFY_STREAM | REDISMODULE_NOTIFY_KEY_MISS) /* A */
#define REDISMODULE_NOTIFY_KEY_MISS (1<<11) /* m (Note: This one is excluded from REDISMODULE_NOTIFY_ALL on purpose) */
#define REDISMODULE_NOTIFY_ALL (REDISMODULE_NOTIFY_GENERIC | REDISMODULE_NOTIFY_STRING | REDISMODULE_NOTIFY_LIST | REDISMODULE_NOTIFY_SET | REDISMODULE_NOTIFY_HASH | REDISMODULE_NOTIFY_ZSET | REDISMODULE_NOTIFY_EXPIRED | REDISMODULE_NOTIFY_EVICTED | REDISMODULE_NOTIFY_STREAM) /* A */
/* A special pointer that we can use between the core and the module to signal
@@ -465,9 +467,14 @@ size_t REDISMODULE_API_FUNC(RedisModule_CallReplyLength)(RedisModuleCallReply *r
RedisModuleCallReply *REDISMODULE_API_FUNC(RedisModule_CallReplyArrayElement)(RedisModuleCallReply *reply, size_t idx);
RedisModuleString *REDISMODULE_API_FUNC(RedisModule_CreateString)(RedisModuleCtx *ctx, const char *ptr, size_t len);
RedisModuleString *REDISMODULE_API_FUNC(RedisModule_CreateStringFromLongLong)(RedisModuleCtx *ctx, long long ll);
RedisModuleString *REDISMODULE_API_FUNC(RedisModule_CreateStringFromDouble)(RedisModuleCtx *ctx, double d);
RedisModuleString *REDISMODULE_API_FUNC(RedisModule_CreateStringFromLongDouble)(RedisModuleCtx *ctx, long double ld, int humanfriendly);
RedisModuleString *REDISMODULE_API_FUNC(RedisModule_CreateStringFromString)(RedisModuleCtx *ctx, const RedisModuleString *str);
#ifdef __GNUC__
RedisModuleString *REDISMODULE_API_FUNC(RedisModule_CreateStringPrintf)(RedisModuleCtx *ctx, const char *fmt, ...) __attribute__ ((format (printf, 2, 3)));
#else
RedisModuleString *REDISMODULE_API_FUNC(RedisModule_CreateStringPrintf)(RedisModuleCtx *ctx, const char *fmt, ...);
#endif
void REDISMODULE_API_FUNC(RedisModule_FreeString)(RedisModuleCtx *ctx, RedisModuleString *str);
const char *REDISMODULE_API_FUNC(RedisModule_StringPtrLen)(const RedisModuleString *str, size_t *len);
int REDISMODULE_API_FUNC(RedisModule_ReplyWithError)(RedisModuleCtx *ctx, const char *err);
@@ -551,8 +558,13 @@ void REDISMODULE_API_FUNC(RedisModule_SaveLongDouble)(RedisModuleIO *io, long do
long double REDISMODULE_API_FUNC(RedisModule_LoadLongDouble)(RedisModuleIO *io);
void *REDISMODULE_API_FUNC(RedisModule_LoadDataTypeFromString)(const RedisModuleString *str, const RedisModuleType *mt);
RedisModuleString *REDISMODULE_API_FUNC(RedisModule_SaveDataTypeToString)(RedisModuleCtx *ctx, void *data, const RedisModuleType *mt);
#ifdef __GNUC__
void REDISMODULE_API_FUNC(RedisModule_Log)(RedisModuleCtx *ctx, const char *level, const char *fmt, ...) __attribute__ ((format (printf, 3, 4)));
void REDISMODULE_API_FUNC(RedisModule_LogIOError)(RedisModuleIO *io, const char *levelstr, const char *fmt, ...) __attribute__ ((format (printf, 3, 4)));
#else
void REDISMODULE_API_FUNC(RedisModule_Log)(RedisModuleCtx *ctx, const char *level, const char *fmt, ...);
void REDISMODULE_API_FUNC(RedisModule_LogIOError)(RedisModuleIO *io, const char *levelstr, const char *fmt, ...);
#endif
void REDISMODULE_API_FUNC(RedisModule__Assert)(const char *estr, const char *file, int line);
void REDISMODULE_API_FUNC(RedisModule_LatencyAddSample)(const char *event, mstime_t latency);
int REDISMODULE_API_FUNC(RedisModule_StringAppendBuffer)(RedisModuleCtx *ctx, RedisModuleString *str, const char *buf, size_t len);
@@ -670,7 +682,7 @@ int REDISMODULE_API_FUNC(RedisModule_AuthenticateClientWithUser)(RedisModuleCtx
void REDISMODULE_API_FUNC(RedisModule_DeauthenticateAndCloseClient)(RedisModuleCtx *ctx, uint64_t client_id);
#endif
#define RedisModule_IsAOFClient(id) ((id) == UINT64_MAX)
#define RedisModule_IsAOFClient(id) ((id) == CLIENT_ID_AOF)
/* This is included inline inside each Redis module. */
static int RedisModule_Init(RedisModuleCtx *ctx, const char *name, int ver, int apiver) __attribute__((unused));
@@ -724,6 +736,7 @@ static int RedisModule_Init(RedisModuleCtx *ctx, const char *name, int ver, int
REDISMODULE_GET_API(CreateStringFromCallReply);
REDISMODULE_GET_API(CreateString);
REDISMODULE_GET_API(CreateStringFromLongLong);
REDISMODULE_GET_API(CreateStringFromDouble);
REDISMODULE_GET_API(CreateStringFromLongDouble);
REDISMODULE_GET_API(CreateStringFromString);
REDISMODULE_GET_API(CreateStringPrintf);
+184 -16
View File
@@ -31,6 +31,7 @@
#include "server.h"
#include "cluster.h"
#include "bio.h"
#include <sys/time.h>
#include <unistd.h>
@@ -44,6 +45,11 @@ void replicationSendAck(void);
void putSlaveOnline(client *slave);
int cancelReplicationHandshake(void);
/* We take a global flag to remember if this instance generated an RDB
* because of replication, so that we can remove the RDB file in case
* the instance is configured to have no persistence. */
int RDBGeneratedByReplication = 0;
/* --------------------------- Utility functions ---------------------------- */
/* Return the pointer to a string representing the slave ip:listening_port
@@ -73,6 +79,34 @@ char *replicationGetSlaveName(client *c) {
return buf;
}
/* Plain unlink() can block for quite some time in order to actually apply
* the file deletion to the filesystem. This call removes the file in a
* background thread instead. We actually just do close() in the thread,
* by using the fact that if there is another instance of the same file open,
* the foreground unlink() will not really do anything, and deleting the
* file will only happen once the last reference is lost. */
int bg_unlink(const char *filename) {
int fd = open(filename,O_RDONLY|O_NONBLOCK);
if (fd == -1) {
/* Can't open the file? Fall back to unlinking in the main thread. */
return unlink(filename);
} else {
/* The following unlink() will not do anything since file
* is still open. */
int retval = unlink(filename);
if (retval == -1) {
/* If we got an unlink error, we just return it, closing the
* new reference we have to the file. */
int old_errno = errno;
close(fd); /* This would overwrite our errno. So we saved it. */
errno = old_errno;
return -1;
}
bioCreateBackgroundJob(BIO_CLOSE_FILE,(void*)(long)fd,NULL,NULL);
return 0; /* Success. */
}
}
/* ---------------------------------- MASTER -------------------------------- */
void createReplicationBacklog(void) {
@@ -128,6 +162,7 @@ void feedReplicationBacklog(void *ptr, size_t len) {
unsigned char *p = ptr;
server.master_repl_offset += len;
server.master_repl_meaningful_offset = server.master_repl_offset;
/* This is a circular buffer, so write as much data we can at every
* iteration and rewind the "idx" index if we reach the limit. */
@@ -590,6 +625,14 @@ int startBgsaveForReplication(int mincapa) {
retval = C_ERR;
}
/* If we succeeded to start a BGSAVE with disk target, let's remember
* this fact, so that we can later delete the file if needed. Note
* that we don't set the flag to 1 if the feature is disabled, otherwise
* it would never be cleared: the file is not deleted. This way if
* the user enables it later with CONFIG SET, we are fine. */
if (retval == C_OK && !socket_target && server.rdb_del_sync_files)
RDBGeneratedByReplication = 1;
/* If we failed to BGSAVE, remove the slaves waiting for a full
* resynchronization from the list of slaves, inform them with
* an error about what happened, close the connection ASAP. */
@@ -882,6 +925,53 @@ void putSlaveOnline(client *slave) {
replicationGetSlaveName(slave));
}
/* We call this function periodically to remove an RDB file that was
* generated because of replication, in an instance that is otherwise
* without any persistence. We don't want instances without persistence
* to take RDB files around, this violates certain policies in certain
* environments. */
void removeRDBUsedToSyncReplicas(void) {
/* If the feature is disabled, return ASAP but also clear the
* RDBGeneratedByReplication flag in case it was set. Otherwise if the
* feature was enabled, but gets disabled later with CONFIG SET, the
* flag may remain set to one: then next time the feature is re-enabled
* via CONFIG SET we have have it set even if no RDB was generated
* because of replication recently. */
if (!server.rdb_del_sync_files) {
RDBGeneratedByReplication = 0;
return;
}
if (allPersistenceDisabled() && RDBGeneratedByReplication) {
client *slave;
listNode *ln;
listIter li;
int delrdb = 1;
listRewind(server.slaves,&li);
while((ln = listNext(&li))) {
slave = ln->value;
if (slave->replstate == SLAVE_STATE_WAIT_BGSAVE_START ||
slave->replstate == SLAVE_STATE_WAIT_BGSAVE_END ||
slave->replstate == SLAVE_STATE_SEND_BULK)
{
delrdb = 0;
break; /* No need to check the other replicas. */
}
}
if (delrdb) {
struct stat sb;
if (lstat(server.rdb_filename,&sb) != -1) {
RDBGeneratedByReplication = 0;
serverLog(LL_NOTICE,
"Removing the RDB file used to feed replicas "
"in a persistence-less instance");
bg_unlink(server.rdb_filename);
}
}
}
}
void sendBulkToSlave(connection *conn) {
client *slave = connGetPrivateData(conn);
char buf[PROTO_IOBUF_LEN];
@@ -893,7 +983,8 @@ void sendBulkToSlave(connection *conn) {
if (slave->replpreamble) {
nwritten = connWrite(conn,slave->replpreamble,sdslen(slave->replpreamble));
if (nwritten == -1) {
serverLog(LL_VERBOSE,"Write error sending RDB preamble to replica: %s",
serverLog(LL_VERBOSE,
"Write error sending RDB preamble to replica: %s",
connGetLastError(conn));
freeClient(slave);
return;
@@ -1338,8 +1429,8 @@ void disklessLoadRestoreBackups(redisDb *backup, int restore, int empty_db_flags
server.db[i] = backup[i];
}
} else {
/* Delete. */
emptyDbGeneric(backup,-1,empty_db_flags,replicationEmptyDbCallback);
/* Delete (Pass EMPTYDB_BACKUP in order to avoid firing module events) . */
emptyDbGeneric(backup,-1,empty_db_flags|EMPTYDB_BACKUP,replicationEmptyDbCallback);
for (int i=0; i<server.dbnum; i++) {
dictRelease(backup[i].dict);
dictRelease(backup[i].expires);
@@ -1351,9 +1442,9 @@ void disklessLoadRestoreBackups(redisDb *backup, int restore, int empty_db_flags
/* Asynchronously read the SYNC payload we receive from a master */
#define REPL_MAX_WRITTEN_BEFORE_FSYNC (1024*1024*8) /* 8 MB */
void readSyncBulkPayload(connection *conn) {
char buf[4096];
char buf[PROTO_IOBUF_LEN];
ssize_t nread, readlen, nwritten;
int use_diskless_load;
int use_diskless_load = useDisklessLoad();
redisDb *diskless_load_backup = NULL;
int empty_db_flags = server.repl_slave_lazy_flush ? EMPTYDB_ASYNC :
EMPTYDB_NO_FLAGS;
@@ -1410,19 +1501,18 @@ void readSyncBulkPayload(connection *conn) {
server.repl_transfer_size = 0;
serverLog(LL_NOTICE,
"MASTER <-> REPLICA sync: receiving streamed RDB from master with EOF %s",
useDisklessLoad()? "to parser":"to disk");
use_diskless_load? "to parser":"to disk");
} else {
usemark = 0;
server.repl_transfer_size = strtol(buf+1,NULL,10);
serverLog(LL_NOTICE,
"MASTER <-> REPLICA sync: receiving %lld bytes from master %s",
(long long) server.repl_transfer_size,
useDisklessLoad()? "to parser":"to disk");
use_diskless_load? "to parser":"to disk");
}
return;
}
use_diskless_load = useDisklessLoad();
if (!use_diskless_load) {
/* Read the data from the socket, store it to a file and search
* for the EOF. */
@@ -1524,7 +1614,6 @@ void readSyncBulkPayload(connection *conn) {
/* We need to stop any AOF rewriting child before flusing and parsing
* the RDB, otherwise we'll create a copy-on-write disaster. */
if (server.aof_state != AOF_OFF) stopAppendOnly();
signalFlushedDb(-1);
/* When diskless RDB loading is used by replicas, it may be configured
* in order to save the current DB instead of throwing it away,
@@ -1532,10 +1621,15 @@ void readSyncBulkPayload(connection *conn) {
if (use_diskless_load &&
server.repl_diskless_load == REPL_DISKLESS_LOAD_SWAPDB)
{
/* Create a backup of server.db[] and initialize to empty
* dictionaries */
diskless_load_backup = disklessLoadMakeBackups();
} else {
emptyDb(-1,empty_db_flags,replicationEmptyDbCallback);
}
/* We call to emptyDb even in case of REPL_DISKLESS_LOAD_SWAPDB
* (Where disklessLoadMakeBackups left server.db empty) because we
* want to execute all the auxiliary logic of emptyDb (Namely,
* fire module events) */
emptyDb(-1,empty_db_flags,replicationEmptyDbCallback);
/* Before loading the DB into memory we need to delete the readable
* handler, otherwise it will get called recursively since
@@ -1616,25 +1710,44 @@ void readSyncBulkPayload(connection *conn) {
killRDBChild();
}
/* Rename rdb like renaming rewrite aof asynchronously. */
int old_rdb_fd = open(server.rdb_filename,O_RDONLY|O_NONBLOCK);
if (rename(server.repl_transfer_tmpfile,server.rdb_filename) == -1) {
serverLog(LL_WARNING,
"Failed trying to rename the temp DB into %s in "
"MASTER <-> REPLICA synchronization: %s",
server.rdb_filename, strerror(errno));
cancelReplicationHandshake();
if (old_rdb_fd != -1) close(old_rdb_fd);
return;
}
/* Close old rdb asynchronously. */
if (old_rdb_fd != -1) bioCreateBackgroundJob(BIO_CLOSE_FILE,(void*)(long)old_rdb_fd,NULL,NULL);
if (rdbLoad(server.rdb_filename,&rsi,RDBFLAGS_REPLICATION) != C_OK) {
serverLog(LL_WARNING,
"Failed trying to load the MASTER synchronization "
"DB from disk");
cancelReplicationHandshake();
if (server.rdb_del_sync_files && allPersistenceDisabled()) {
serverLog(LL_NOTICE,"Removing the RDB file obtained from "
"the master. This replica has persistence "
"disabled");
bg_unlink(server.rdb_filename);
}
/* Note that there's no point in restarting the AOF on sync failure,
it'll be restarted when sync succeeds or replica promoted. */
return;
}
/* Cleanup. */
if (server.rdb_del_sync_files && allPersistenceDisabled()) {
serverLog(LL_NOTICE,"Removing the RDB file obtained from "
"the master. This replica has persistence "
"disabled");
bg_unlink(server.rdb_filename);
}
zfree(server.repl_transfer_tmpfile);
close(server.repl_transfer_fd);
server.repl_transfer_fd = -1;
@@ -1656,6 +1769,7 @@ void readSyncBulkPayload(connection *conn) {
* we are starting a new history. */
memcpy(server.replid,server.master->replid,sizeof(server.replid));
server.master_repl_offset = server.master->reploff;
server.master_repl_meaningful_offset = server.master->reploff;
clearReplicationId2();
/* Let's create the replication backlog if needed. Slaves need to
@@ -2172,6 +2286,10 @@ void syncWithMaster(connection *conn) {
if (psync_result == PSYNC_CONTINUE) {
serverLog(LL_NOTICE, "MASTER <-> REPLICA sync: Master accepted a Partial Resynchronization.");
if (server.supervised_mode == SUPERVISED_SYSTEMD) {
redisCommunicateSystemd("STATUS=MASTER <-> REPLICA sync: Partial Resynchronization accepted. Ready to accept connections.\n");
redisCommunicateSystemd("READY=1\n");
}
return;
}
@@ -2392,6 +2510,10 @@ void replicationUnsetMaster(void) {
moduleFireServerEvent(REDISMODULE_EVENT_REPLICATION_ROLE_CHANGED,
REDISMODULE_EVENT_REPLROLECHANGED_NOW_MASTER,
NULL);
/* Restart the AOF subsystem in case we shut it down during a sync when
* we were still a slave. */
if (server.aof_enabled && server.aof_state == AOF_OFF) restartAOFAfterSYNC();
}
/* This function is called when the slave lose the connection with the
@@ -2429,9 +2551,6 @@ void replicaofCommand(client *c) {
serverLog(LL_NOTICE,"MASTER MODE enabled (user request from '%s')",
client);
sdsfree(client);
/* Restart the AOF subsystem in case we shut it down during a sync when
* we were still a slave. */
if (server.aof_enabled && server.aof_state == AOF_OFF) restartAOFAfterSYNC();
}
} else {
long port;
@@ -2608,9 +2727,47 @@ void replicationCacheMaster(client *c) {
* current offset if no data was lost during the failover. So we use our
* current replication ID and offset in order to synthesize a cached master. */
void replicationCacheMasterUsingMyself(void) {
serverLog(LL_NOTICE,
"Before turning into a replica, using my own master parameters "
"to synthesize a cached master: I may be able to synchronize with "
"the new master with just a partial transfer.");
/* This will be used to populate the field server.master->reploff
* by replicationCreateMasterClient(). We'll later set the created
* master as server.cached_master, so the replica will use such
* offset for PSYNC. */
server.master_initial_offset = server.master_repl_offset;
/* However if the "meaningful" offset, that is the offset without
* the final PINGs in the stream, is different, use this instead:
* often when the master is no longer reachable, replicas will never
* receive the PINGs, however the master will end with an incremented
* offset because of the PINGs and will not be able to incrementally
* PSYNC with the new master. */
if (server.master_repl_offset > server.master_repl_meaningful_offset) {
long long delta = server.master_repl_offset -
server.master_repl_meaningful_offset;
serverLog(LL_NOTICE,
"Using the meaningful offset %lld instead of %lld to exclude "
"the final PINGs (%lld bytes difference)",
server.master_repl_meaningful_offset,
server.master_repl_offset,
delta);
server.master_initial_offset = server.master_repl_meaningful_offset;
server.master_repl_offset = server.master_repl_meaningful_offset;
if (server.repl_backlog_histlen <= delta) {
server.repl_backlog_histlen = 0;
server.repl_backlog_idx = 0;
} else {
server.repl_backlog_histlen -= delta;
server.repl_backlog_idx =
(server.repl_backlog_idx + (server.repl_backlog_size - delta)) %
server.repl_backlog_size;
}
}
/* The master client we create can be set to any DBID, because
* the new master will start its replication stream with SELECT. */
server.master_initial_offset = server.master_repl_offset;
replicationCreateMasterClient(NULL,-1);
/* Use our own ID / offset. */
@@ -2620,7 +2777,6 @@ void replicationCacheMasterUsingMyself(void) {
unlinkClient(server.master);
server.cached_master = server.master;
server.master = NULL;
serverLog(LL_NOTICE,"Before turning into a replica, using my master parameters to synthesize a cached master: I may be able to synchronize with the new master with just a partial transfer.");
}
/* Free a cached master, called when there are no longer the conditions for
@@ -3000,10 +3156,18 @@ void replicationCron(void) {
clientsArePaused();
if (!manual_failover_in_progress) {
long long before_ping = server.master_repl_meaningful_offset;
ping_argv[0] = createStringObject("PING",4);
replicationFeedSlaves(server.slaves, server.slaveseldb,
ping_argv, 1);
decrRefCount(ping_argv[0]);
/* The server.master_repl_meaningful_offset variable represents
* the offset of the replication stream without the pending PINGs.
* This is useful to set the right replication offset for PSYNC
* when the master is turned into a replica. Otherwise pending
* PINGs may not allow it to perform an incremental sync with the
* new master. */
server.master_repl_meaningful_offset = before_ping;
}
}
@@ -3138,6 +3302,10 @@ void replicationCron(void) {
}
}
/* Remove the RDB file used for replication if Redis is not running
* with any persistence. */
removeRDBUsedToSyncReplicas();
/* Refresh the number of slaves with lag <= min-slaves-max-lag. */
refreshGoodSlavesCount();
replication_cron_loops++; /* Incremented with frequency 1 HZ. */
+8 -5
View File
@@ -606,8 +606,10 @@ int luaRedisGenericCommand(lua_State *lua, int raise_error) {
}
/* Check the ACLs. */
int acl_retval = ACLCheckCommandPerm(c);
int acl_keypos;
int acl_retval = ACLCheckCommandPerm(c,&acl_keypos);
if (acl_retval != ACL_OK) {
addACLLogEntry(c,acl_retval,acl_keypos,NULL);
if (acl_retval == ACL_DENIED_CMD)
luaPushError(lua, "The user executing the script can't run this "
"command or subcommand");
@@ -655,12 +657,11 @@ int luaRedisGenericCommand(lua_State *lua, int raise_error) {
!server.loading && /* Don't care about mem if loading. */
!server.masterhost && /* Slave must execute the script. */
server.lua_write_dirty == 0 && /* Script had no side effects so far. */
server.lua_oom && /* Detected OOM when script start. */
(cmd->flags & CMD_DENYOOM))
{
if (getMaxmemoryState(NULL,NULL,NULL,NULL) != C_OK) {
luaPushError(lua, shared.oomerr->ptr);
goto cleanup;
}
luaPushError(lua, shared.oomerr->ptr);
goto cleanup;
}
if (cmd->flags & CMD_RANDOM) server.lua_random_dirty = 1;
@@ -958,6 +959,7 @@ int luaLogCommand(lua_State *lua) {
lua_pushstring(lua, "Invalid debug level.");
return lua_error(lua);
}
if (level < server.verbosity) return 0;
/* Glue together all the arguments */
log = sdsempty();
@@ -2473,6 +2475,7 @@ void ldbEval(lua_State *lua, sds *argv, int argc) {
ldbLog(sdscatfmt(sdsempty(),"<error> %s",lua_tostring(lua,-1)));
lua_pop(lua,1);
sdsfree(code);
sdsfree(expr);
return;
}
}
+1 -1
View File
@@ -34,7 +34,7 @@
#define __SDS_H
#define SDS_MAX_PREALLOC (1024*1024)
const char *SDS_NOINIT;
extern const char *SDS_NOINIT;
#include <sys/types.h>
#include <stdarg.h>
+5
View File
@@ -36,7 +36,12 @@
* the include of your alternate allocator if needed (not needed in order
* to use the default libc allocator). */
#ifndef __SDS_ALLOC_H__
#define __SDS_ALLOC_H__
#include "zmalloc.h"
#define s_malloc zmalloc
#define s_realloc zrealloc
#define s_free zfree
#endif
+40 -9
View File
@@ -205,7 +205,8 @@ typedef struct sentinelRedisInstance {
dict *slaves; /* Slaves for this master instance. */
unsigned int quorum;/* Number of sentinels that need to agree on failure. */
int parallel_syncs; /* How many slaves to reconfigure at same time. */
char *auth_pass; /* Password to use for AUTH against master & slaves. */
char *auth_pass; /* Password to use for AUTH against master & replica. */
char *auth_user; /* Username for ACLs AUTH against master & replica. */
/* Slave specific. */
mstime_t master_link_down_time; /* Slave replication link down time. */
@@ -1231,6 +1232,7 @@ sentinelRedisInstance *createSentinelRedisInstance(char *name, int flags, char *
SENTINEL_DEFAULT_DOWN_AFTER;
ri->master_link_down_time = 0;
ri->auth_pass = NULL;
ri->auth_user = NULL;
ri->slave_priority = SENTINEL_DEFAULT_SLAVE_PRIORITY;
ri->slave_reconf_sent_time = 0;
ri->slave_master_host = NULL;
@@ -1289,6 +1291,7 @@ void releaseSentinelRedisInstance(sentinelRedisInstance *ri) {
sdsfree(ri->slave_master_host);
sdsfree(ri->leader);
sdsfree(ri->auth_pass);
sdsfree(ri->auth_user);
sdsfree(ri->info);
releaseSentinelAddr(ri->addr);
dictRelease(ri->renamed_commands);
@@ -1654,19 +1657,19 @@ char *sentinelHandleConfiguration(char **argv, int argc) {
ri->failover_timeout = atoi(argv[2]);
if (ri->failover_timeout <= 0)
return "negative or zero time parameter.";
} else if (!strcasecmp(argv[0],"parallel-syncs") && argc == 3) {
} else if (!strcasecmp(argv[0],"parallel-syncs") && argc == 3) {
/* parallel-syncs <name> <milliseconds> */
ri = sentinelGetMasterByName(argv[1]);
if (!ri) return "No such master with specified name.";
ri->parallel_syncs = atoi(argv[2]);
} else if (!strcasecmp(argv[0],"notification-script") && argc == 3) {
} else if (!strcasecmp(argv[0],"notification-script") && argc == 3) {
/* notification-script <name> <path> */
ri = sentinelGetMasterByName(argv[1]);
if (!ri) return "No such master with specified name.";
if (access(argv[2],X_OK) == -1)
return "Notification script seems non existing or non executable.";
ri->notification_script = sdsnew(argv[2]);
} else if (!strcasecmp(argv[0],"client-reconfig-script") && argc == 3) {
} else if (!strcasecmp(argv[0],"client-reconfig-script") && argc == 3) {
/* client-reconfig-script <name> <path> */
ri = sentinelGetMasterByName(argv[1]);
if (!ri) return "No such master with specified name.";
@@ -1674,11 +1677,16 @@ char *sentinelHandleConfiguration(char **argv, int argc) {
return "Client reconfiguration script seems non existing or "
"non executable.";
ri->client_reconfig_script = sdsnew(argv[2]);
} else if (!strcasecmp(argv[0],"auth-pass") && argc == 3) {
} else if (!strcasecmp(argv[0],"auth-pass") && argc == 3) {
/* auth-pass <name> <password> */
ri = sentinelGetMasterByName(argv[1]);
if (!ri) return "No such master with specified name.";
ri->auth_pass = sdsnew(argv[2]);
} else if (!strcasecmp(argv[0],"auth-user") && argc == 3) {
/* auth-user <name> <username> */
ri = sentinelGetMasterByName(argv[1]);
if (!ri) return "No such master with specified name.";
ri->auth_user = sdsnew(argv[2]);
} else if (!strcasecmp(argv[0],"current-epoch") && argc == 2) {
/* current-epoch <epoch> */
unsigned long long current_epoch = strtoull(argv[1],NULL,10);
@@ -1836,7 +1844,7 @@ void rewriteConfigSentinelOption(struct rewriteConfigState *state) {
rewriteConfigRewriteLine(state,"sentinel",line,1);
}
/* sentinel auth-pass */
/* sentinel auth-pass & auth-user */
if (master->auth_pass) {
line = sdscatprintf(sdsempty(),
"sentinel auth-pass %s %s",
@@ -1844,6 +1852,13 @@ void rewriteConfigSentinelOption(struct rewriteConfigState *state) {
rewriteConfigRewriteLine(state,"sentinel",line,1);
}
if (master->auth_user) {
line = sdscatprintf(sdsempty(),
"sentinel auth-user %s %s",
master->name, master->auth_user);
rewriteConfigRewriteLine(state,"sentinel",line,1);
}
/* sentinel config-epoch */
line = sdscatprintf(sdsempty(),
"sentinel config-epoch %s %llu",
@@ -1968,19 +1983,29 @@ werr:
* will disconnect and reconnect the link and so forth. */
void sentinelSendAuthIfNeeded(sentinelRedisInstance *ri, redisAsyncContext *c) {
char *auth_pass = NULL;
char *auth_user = NULL;
if (ri->flags & SRI_MASTER) {
auth_pass = ri->auth_pass;
auth_user = ri->auth_user;
} else if (ri->flags & SRI_SLAVE) {
auth_pass = ri->master->auth_pass;
auth_user = ri->master->auth_user;
} else if (ri->flags & SRI_SENTINEL) {
auth_pass = ACLDefaultUserFirstPassword();
auth_pass = server.requirepass;
auth_user = NULL;
}
if (auth_pass) {
if (auth_pass && auth_user == NULL) {
if (redisAsyncCommand(c, sentinelDiscardReplyCallback, ri, "%s %s",
sentinelInstanceMapCommand(ri,"AUTH"),
auth_pass) == C_OK) ri->link->pending_commands++;
} else if (auth_pass && auth_user) {
/* If we also have an username, use the ACL-style AUTH command
* with two arguments, username and password. */
if (redisAsyncCommand(c, sentinelDiscardReplyCallback, ri, "%s %s %s",
sentinelInstanceMapCommand(ri,"AUTH"),
auth_user, auth_pass) == C_OK) ri->link->pending_commands++;
}
}
@@ -3522,6 +3547,12 @@ void sentinelSetCommand(client *c) {
sdsfree(ri->auth_pass);
ri->auth_pass = strlen(value) ? sdsnew(value) : NULL;
changes++;
} else if (!strcasecmp(option,"auth-user") && moreargs > 0) {
/* auth-user <username> */
char *value = c->argv[++j]->ptr;
sdsfree(ri->auth_user);
ri->auth_user = strlen(value) ? sdsnew(value) : NULL;
changes++;
} else if (!strcasecmp(option,"quorum") && moreargs > 0) {
/* quorum <count> */
robj *o = c->argv[++j];
@@ -4308,7 +4339,7 @@ void sentinelFailoverDetectEnd(sentinelRedisInstance *master) {
sentinelRedisInstance *slave = dictGetVal(de);
int retval;
if (slave->flags & (SRI_RECONF_DONE|SRI_RECONF_SENT)) continue;
if (slave->flags & (SRI_PROMOTED|SRI_RECONF_DONE|SRI_RECONF_SENT)) continue;
if (slave->link->disconnected) continue;
retval = sentinelSendSlaveOf(slave,
+127 -65
View File
@@ -238,6 +238,10 @@ struct redisCommand redisCommandTable[] = {
"write use-memory @bitmap",
0,NULL,1,1,1,0,0,0},
{"bitfield_ro",bitfieldroCommand,-2,
"read-only fast @bitmap",
0,NULL,1,1,1,0,0,0},
{"setrange",setrangeCommand,4,
"write use-memory @string",
0,NULL,1,1,1,0,0,0},
@@ -579,7 +583,7 @@ struct redisCommand redisCommandTable[] = {
0,NULL,0,0,0,0,0,0},
{"select",selectCommand,2,
"ok-loading fast @keyspace",
"ok-loading fast ok-stale @keyspace",
0,NULL,0,0,0,0,0,0},
{"swapdb",swapdbCommand,3,
@@ -660,7 +664,7 @@ struct redisCommand redisCommandTable[] = {
0,NULL,0,0,0,0,0,0},
{"lastsave",lastsaveCommand,1,
"read-only random fast @admin @dangerous",
"read-only random fast ok-loading ok-stale @admin @dangerous",
0,NULL,0,0,0,0,0,0},
{"type",typeCommand,2,
@@ -668,15 +672,15 @@ struct redisCommand redisCommandTable[] = {
0,NULL,1,1,1,0,0,0},
{"multi",multiCommand,1,
"no-script fast @transaction",
"no-script fast ok-loading ok-stale @transaction",
0,NULL,0,0,0,0,0,0},
{"exec",execCommand,1,
"no-script no-monitor no-slowlog @transaction",
"no-script no-monitor no-slowlog ok-loading ok-stale @transaction",
0,NULL,0,0,0,0,0,0},
{"discard",discardCommand,1,
"no-script fast @transaction",
"no-script fast ok-loading ok-stale @transaction",
0,NULL,0,0,0,0,0,0},
{"sync",syncCommand,1,
@@ -708,7 +712,7 @@ struct redisCommand redisCommandTable[] = {
0,NULL,0,0,0,0,0,0},
{"monitor",monitorCommand,1,
"admin no-script",
"admin no-script ok-loading ok-stale",
0,NULL,0,0,0,0,0,0},
{"ttl",ttlCommand,2,
@@ -740,7 +744,7 @@ struct redisCommand redisCommandTable[] = {
0,NULL,0,0,0,0,0,0},
{"debug",debugCommand,-2,
"admin no-script",
"admin no-script ok-loading ok-stale",
0,NULL,0,0,0,0,0,0},
{"config",configCommand,-2,
@@ -817,14 +821,14 @@ struct redisCommand redisCommandTable[] = {
{"memory",memoryCommand,-2,
"random read-only",
0,NULL,0,0,0,0,0,0},
0,memoryGetKeys,0,0,0,0,0,0},
{"client",clientCommand,-2,
"admin no-script random @connection",
"admin no-script random ok-loading ok-stale @connection",
0,NULL,0,0,0,0,0,0},
{"hello",helloCommand,-2,
"no-auth no-script fast no-monitor no-slowlog @connection",
"no-auth no-script fast no-monitor ok-loading ok-stale no-slowlog @connection",
0,NULL,0,0,0,0,0,0},
/* EVAL can modify the dataset, however it is not flagged as a write
@@ -838,7 +842,7 @@ struct redisCommand redisCommandTable[] = {
0,evalGetKeys,0,0,0,0,0,0},
{"slowlog",slowlogCommand,-2,
"admin random",
"admin random ok-loading ok-stale",
0,NULL,0,0,0,0,0,0},
{"script",scriptCommand,-2,
@@ -846,7 +850,7 @@ struct redisCommand redisCommandTable[] = {
0,NULL,0,0,0,0,0,0},
{"time",timeCommand,1,
"read-only random fast",
"read-only random fast ok-loading ok-stale",
0,NULL,0,0,0,0,0,0},
{"bitop",bitopCommand,-4,
@@ -943,11 +947,11 @@ struct redisCommand redisCommandTable[] = {
0,NULL,1,1,1,0,0,0},
{"xread",xreadCommand,-4,
"read-only no-script @stream @blocking",
"read-only @stream @blocking",
0,xreadGetKeys,1,1,1,0,0,0},
{"xreadgroup",xreadCommand,-7,
"write no-script @stream @blocking",
"write @stream @blocking",
0,xreadGetKeys,1,1,1,0,0,0},
{"xgroup",xgroupCommand,-2,
@@ -1000,7 +1004,11 @@ struct redisCommand redisCommandTable[] = {
{"acl",aclCommand,-2,
"admin no-script no-slowlog ok-loading ok-stale",
0,NULL,0,0,0,0,0,0}
0,NULL,0,0,0,0,0,0},
{"lcs",lcsCommand,-4,
"write use-memory @string",
0,lcsGetKeys,0,0,0,0,0,0}
};
/*============================ Utility functions ============================ */
@@ -1455,12 +1463,20 @@ void updateDictResizePolicy(void) {
dictDisableResize();
}
/* Return true if there are no active children processes doing RDB saving,
* AOF rewriting, or some side process spawned by a loaded module. */
int hasActiveChildProcess() {
return server.rdb_child_pid != -1 ||
server.aof_child_pid != -1 ||
server.module_child_pid != -1;
}
/* Return true if this instance has persistence completely turned off:
* both RDB and AOF are disabled. */
int allPersistenceDisabled(void) {
return server.saveparamslen == 0 && server.aof_state == AOF_OFF;
}
/* ======================= Cron: called every 100 ms ======================== */
/* Add a sample to the operations per second array of samples. */
@@ -1490,42 +1506,6 @@ long long getInstantaneousMetric(int metric) {
return sum / STATS_METRIC_SAMPLES;
}
/* Check for timeouts. Returns non-zero if the client was terminated.
* The function gets the current time in milliseconds as argument since
* it gets called multiple times in a loop, so calling gettimeofday() for
* each iteration would be costly without any actual gain. */
int clientsCronHandleTimeout(client *c, mstime_t now_ms) {
time_t now = now_ms/1000;
if (server.maxidletime &&
!(c->flags & CLIENT_SLAVE) && /* no timeout for slaves */
!(c->flags & CLIENT_MASTER) && /* no timeout for masters */
!(c->flags & CLIENT_BLOCKED) && /* no timeout for BLPOP */
!(c->flags & CLIENT_PUBSUB) && /* no timeout for Pub/Sub clients */
(now - c->lastinteraction > server.maxidletime))
{
serverLog(LL_VERBOSE,"Closing idle client");
freeClient(c);
return 1;
} else if (c->flags & CLIENT_BLOCKED) {
/* Blocked OPS timeout is handled with milliseconds resolution.
* However note that the actual resolution is limited by
* server.hz. */
if (c->bpop.timeout != 0 && c->bpop.timeout < now_ms) {
/* Handle blocking operation specific timeout. */
replyToBlockedClientTimedOut(c);
unblockClient(c);
} else if (server.cluster_enabled) {
/* Cluster: handle unblock & redirect of clients blocked
* into keys no longer served by this server. */
if (clusterRedirectBlockedClientIfNeeded(c))
unblockClient(c);
}
}
return 0;
}
/* The client query buffer is an sds.c string that can end with a lot of
* free space not used, this function reclaims space if needed.
*
@@ -1613,6 +1593,28 @@ int clientsCronTrackExpansiveClients(client *c) {
return 0; /* This function never terminates the client. */
}
/* Iterating all the clients in getMemoryOverheadData() is too slow and
* in turn would make the INFO command too slow. So we perform this
* computation incrementally and track the (not instantaneous but updated
* to the second) total memory used by clients using clinetsCron() in
* a more incremental way (depending on server.hz). */
int clientsCronTrackClientsMemUsage(client *c) {
size_t mem = 0;
int type = getClientType(c);
mem += getClientOutputBufferMemoryUsage(c);
mem += sdsAllocSize(c->querybuf);
mem += sizeof(client);
/* Now that we have the memory used by the client, remove the old
* value from the old categoty, and add it back. */
server.stat_clients_type_memory[c->client_cron_last_memory_type] -=
c->client_cron_last_memory_usage;
server.stat_clients_type_memory[type] += mem;
/* Remember what we added and where, to remove it next time. */
c->client_cron_last_memory_usage = mem;
c->client_cron_last_memory_type = type;
return 0;
}
/* Return the max samples in the memory usage of clients tracked by
* the function clientsCronTrackExpansiveClients(). */
void getExpansiveClientsInfo(size_t *in_usage, size_t *out_usage) {
@@ -1673,6 +1675,7 @@ void clientsCron(void) {
if (clientsCronHandleTimeout(c,now)) continue;
if (clientsCronResizeQueryBuffer(c)) continue;
if (clientsCronTrackExpansiveClients(c)) continue;
if (clientsCronTrackClientsMemUsage(c)) continue;
}
}
@@ -1683,7 +1686,7 @@ void databasesCron(void) {
/* Expire keys by random sampling. Not required for slaves
* as master will synthesize DELs for us. */
if (server.active_expire_enabled) {
if (server.masterhost == NULL) {
if (iAmMaster()) {
activeExpireCycle(ACTIVE_EXPIRE_CYCLE_SLOW);
} else {
expireSlaveKeys();
@@ -2080,8 +2083,15 @@ int serverCron(struct aeEventLoop *eventLoop, long long id, void *clientData) {
void beforeSleep(struct aeEventLoop *eventLoop) {
UNUSED(eventLoop);
/* Handle precise timeouts of blocked clients. */
handleBlockedClientsTimeout();
/* We should handle pending reads clients ASAP after event loop. */
handleClientsWithPendingReadsUsingThreads();
/* Handle TLS pending data. (must be done before flushAppendOnlyFile) */
tlsProcessPendingData();
/* If tls still has pending unread data don't sleep at all. */
aeSetDontWait(server.el, tlsHasPendingData());
@@ -2124,6 +2134,10 @@ void beforeSleep(struct aeEventLoop *eventLoop) {
if (listLength(server.unblocked_clients))
processUnblockedClients();
/* Send the invalidation messages to clients participating to the
* client side caching protocol in broadcasting (BCAST) mode. */
trackingBroadcastInvalidationMessages();
/* Write the AOF buffer on disk */
flushAppendOnlyFile(0);
@@ -2145,7 +2159,6 @@ void beforeSleep(struct aeEventLoop *eventLoop) {
void afterSleep(struct aeEventLoop *eventLoop) {
UNUSED(eventLoop);
if (moduleCount()) moduleAcquireGIL();
handleClientsWithPendingReadsUsingThreads();
}
/* =========================== Server initialization ======================== */
@@ -2337,6 +2350,7 @@ void initServerConfig(void) {
server.repl_syncio_timeout = CONFIG_REPL_SYNCIO_TIMEOUT;
server.repl_down_since = 0; /* Never connected, repl is down since EVER. */
server.master_repl_offset = 0;
server.master_repl_meaningful_offset = 0;
/* Replication partial resync backlog */
server.repl_backlog = NULL;
@@ -2674,6 +2688,7 @@ void resetServerStats(void) {
}
server.stat_net_input_bytes = 0;
server.stat_net_output_bytes = 0;
server.stat_unexpected_error_replies = 0;
server.aof_delayed_fsync = 0;
}
@@ -2702,6 +2717,7 @@ void initServer(void) {
server.monitors = listCreate();
server.clients_pending_write = listCreate();
server.clients_pending_read = listCreate();
server.clients_timeout_table = raxNew();
server.slaveseldb = -1; /* Force to emit the first SELECT command. */
server.unblocked_clients = listCreate();
server.ready_keys = listCreate();
@@ -2768,6 +2784,7 @@ void initServer(void) {
evictionPoolAlloc(); /* Initialize the LRU keys pool. */
server.pubsub_channels = dictCreate(&keylistDictType,NULL);
server.pubsub_patterns = listCreate();
server.pubsub_patterns_dict = dictCreate(&keylistDictType,NULL);
listSetFreeMethod(server.pubsub_patterns,freePubsubPattern);
listSetMatchMethod(server.pubsub_patterns,listMatchPubsubPattern);
server.cronloops = 0;
@@ -2798,6 +2815,8 @@ void initServer(void) {
server.stat_rdb_cow_bytes = 0;
server.stat_aof_cow_bytes = 0;
server.stat_module_cow_bytes = 0;
for (int j = 0; j < CLIENT_TYPE_COUNT; j++)
server.stat_clients_type_memory[j] = 0;
server.cron_malloc_stats.zmalloc_used = 0;
server.cron_malloc_stats.process_rss = 0;
server.cron_malloc_stats.allocator_allocated = 0;
@@ -3277,12 +3296,16 @@ void call(client *c, int flags) {
if (flags & CMD_CALL_PROPAGATE) {
int multi_emitted = 0;
/* Wrap the commands in server.also_propagate array,
* but don't wrap it if we are already in MULIT context,
* in case the nested MULIT/EXEC.
* but don't wrap it if we are already in MULTI context,
* in case the nested MULTI/EXEC.
*
* And if the array contains only one command, no need to
* wrap it, since the single command is atomic. */
if (server.also_propagate.numops > 1 && !(c->flags & CLIENT_MULTI)) {
if (server.also_propagate.numops > 1 &&
!(c->cmd->flags & CMD_MODULE) &&
!(c->flags & CLIENT_MULTI) &&
!(flags & CMD_CALL_NOWRAP))
{
execCommandPropagateMulti(c);
multi_emitted = 1;
}
@@ -3310,8 +3333,11 @@ void call(client *c, int flags) {
if (c->cmd->flags & CMD_READONLY) {
client *caller = (c->flags & CLIENT_LUA && server.lua_caller) ?
server.lua_caller : c;
if (caller->flags & CLIENT_TRACKING)
if (caller->flags & CLIENT_TRACKING &&
!(caller->flags & CLIENT_TRACKING_BCAST))
{
trackingRememberKeys(caller);
}
}
server.fixed_time_expire--;
@@ -3363,7 +3389,7 @@ int processCommand(client *c) {
/* Check if the user is authenticated. This check is skipped in case
* the default user is flagged as "nopass" and is active. */
int auth_required = (!(DefaultUser->flags & USER_FLAG_NOPASS) ||
DefaultUser->flags & USER_FLAG_DISABLED) &&
(DefaultUser->flags & USER_FLAG_DISABLED)) &&
!c->authenticated;
if (auth_required) {
/* AUTH and HELLO and no auth modules are valid even in
@@ -3377,8 +3403,10 @@ int processCommand(client *c) {
/* Check if the user can run this command according to the current
* ACLs. */
int acl_retval = ACLCheckCommandPerm(c);
int acl_keypos;
int acl_retval = ACLCheckCommandPerm(c,&acl_keypos);
if (acl_retval != ACL_OK) {
addACLLogEntry(c,acl_retval,acl_keypos,NULL);
flagTransaction(c);
if (acl_retval == ACL_DENIED_CMD)
addReplyErrorFormat(c,
@@ -3442,6 +3470,13 @@ int processCommand(client *c) {
addReply(c, shared.oomerr);
return C_OK;
}
/* Save out_of_memory result at script start, otherwise if we check OOM
* untill first write within script, memory used by lua stack and
* arguments might interfere. */
if (c->cmd->proc == evalCommand || c->cmd->proc == evalShaCommand) {
server.lua_oom = out_of_memory;
}
}
/* Make sure to use a reasonable amount of memory for client side
@@ -3486,6 +3521,7 @@ int processCommand(client *c) {
!(c->flags & CLIENT_MASTER) &&
c->cmd->flags & CMD_WRITE)
{
flagTransaction(c);
addReply(c, shared.roslaveerr);
return C_OK;
}
@@ -3498,7 +3534,10 @@ int processCommand(client *c) {
c->cmd->proc != unsubscribeCommand &&
c->cmd->proc != psubscribeCommand &&
c->cmd->proc != punsubscribeCommand) {
addReplyError(c,"only (P)SUBSCRIBE / (P)UNSUBSCRIBE / PING / QUIT allowed in this context");
addReplyErrorFormat(c,
"Can't execute '%s': only (P)SUBSCRIBE / "
"(P)UNSUBSCRIBE / PING / QUIT are allowed in this context",
c->cmd->name);
return C_OK;
}
@@ -3521,11 +3560,19 @@ int processCommand(client *c) {
return C_OK;
}
/* Lua script too slow? Only allow a limited number of commands. */
/* Lua script too slow? Only allow a limited number of commands.
* Note that we need to allow the transactions commands, otherwise clients
* sending a transaction with pipelining without error checking, may have
* the MULTI plus a few initial commands refused, then the timeout
* condition resolves, and the bottom-half of the transaction gets
* executed, see Github PR #7022. */
if (server.lua_timedout &&
c->cmd->proc != authCommand &&
c->cmd->proc != helloCommand &&
c->cmd->proc != replconfCommand &&
c->cmd->proc != multiCommand &&
c->cmd->proc != execCommand &&
c->cmd->proc != discardCommand &&
!(c->cmd->proc == shutdownCommand &&
c->argc == 2 &&
tolower(((char*)c->argv[1]->ptr)[0]) == 'n') &&
@@ -3761,6 +3808,7 @@ void addReplyCommand(client *c, struct redisCommand *cmd) {
flagcount += addReplyCommandFlag(c,cmd,CMD_SKIP_SLOWLOG, "skip_slowlog");
flagcount += addReplyCommandFlag(c,cmd,CMD_ASKING, "asking");
flagcount += addReplyCommandFlag(c,cmd,CMD_FAST, "fast");
flagcount += addReplyCommandFlag(c,cmd,CMD_NO_AUTH, "no_auth");
if ((cmd->getkeys_proc && !(cmd->flags & CMD_MODULE)) ||
cmd->flags & CMD_MODULE_GETKEYS)
{
@@ -3963,11 +4011,13 @@ sds genRedisInfoString(const char *section) {
"client_recent_max_input_buffer:%zu\r\n"
"client_recent_max_output_buffer:%zu\r\n"
"blocked_clients:%d\r\n"
"tracking_clients:%d\r\n",
"tracking_clients:%d\r\n"
"clients_in_timeout_table:%llu\r\n",
listLength(server.clients)-listLength(server.slaves),
maxin, maxout,
server.blocked_clients,
server.tracking_clients);
server.tracking_clients,
(unsigned long long) raxSize(server.clients_timeout_table));
}
/* Memory */
@@ -4216,7 +4266,9 @@ sds genRedisInfoString(const char *section) {
"active_defrag_misses:%lld\r\n"
"active_defrag_key_hits:%lld\r\n"
"active_defrag_key_misses:%lld\r\n"
"tracking_used_slots:%lld\r\n",
"tracking_total_keys:%lld\r\n"
"tracking_total_items:%lld\r\n"
"unexpected_error_replies:%lld\r\n",
server.stat_numconnections,
server.stat_numcommands,
getInstantaneousMetric(STATS_METRIC_COMMAND),
@@ -4244,7 +4296,9 @@ sds genRedisInfoString(const char *section) {
server.stat_active_defrag_misses,
server.stat_active_defrag_key_hits,
server.stat_active_defrag_key_misses,
trackingGetUsedSlots());
(unsigned long long) trackingGetTotalKeys(),
(unsigned long long) trackingGetTotalItems(),
server.stat_unexpected_error_replies);
}
/* Replication */
@@ -4360,6 +4414,7 @@ sds genRedisInfoString(const char *section) {
"master_replid:%s\r\n"
"master_replid2:%s\r\n"
"master_repl_offset:%lld\r\n"
"master_repl_meaningful_offset:%lld\r\n"
"second_repl_offset:%lld\r\n"
"repl_backlog_active:%d\r\n"
"repl_backlog_size:%lld\r\n"
@@ -4368,6 +4423,7 @@ sds genRedisInfoString(const char *section) {
server.replid,
server.replid2,
server.master_repl_offset,
server.master_repl_meaningful_offset,
server.second_replid_offset,
server.repl_backlog != NULL,
server.repl_backlog_size,
@@ -4745,6 +4801,7 @@ void loadDataFromDisk(void) {
{
memcpy(server.replid,rsi.repl_id,sizeof(server.replid));
server.master_repl_offset = rsi.repl_offset;
server.master_repl_meaningful_offset = rsi.repl_offset;
/* If we are a slave, create a cached master from this
* information, in order to allow partial resynchronizations
* with masters. */
@@ -4838,6 +4895,11 @@ int redisIsSupervised(int mode) {
return 0;
}
int iAmMaster(void) {
return ((!server.cluster_enabled && server.masterhost == NULL) ||
(server.cluster_enabled && nodeIsMaster(server.cluster->myself)));
}
int main(int argc, char **argv) {
struct timeval tv;
+67 -15
View File
@@ -247,6 +247,12 @@ typedef long long ustime_t; /* microsecond time type. */
#define CLIENT_TRACKING (1ULL<<31) /* Client enabled keys tracking in order to
perform client side caching. */
#define CLIENT_TRACKING_BROKEN_REDIR (1ULL<<32) /* Target client is invalid. */
#define CLIENT_TRACKING_BCAST (1ULL<<33) /* Tracking in BCAST mode. */
#define CLIENT_TRACKING_OPTIN (1ULL<<34) /* Tracking in opt-in mode. */
#define CLIENT_TRACKING_OPTOUT (1ULL<<35) /* Tracking in opt-out mode. */
#define CLIENT_TRACKING_CACHING (1ULL<<36) /* CACHING yes/no was given,
depending on optin/optout mode. */
#define CLIENT_IN_TO_TABLE (1ULL<<37) /* This client is in the timeout table. */
/* Client block type (btype field in client structure)
* if CLIENT_BLOCKED flag is set. */
@@ -268,6 +274,7 @@ typedef long long ustime_t; /* microsecond time type. */
#define CLIENT_TYPE_SLAVE 1 /* Slaves. */
#define CLIENT_TYPE_PUBSUB 2 /* Clients subscribed to PubSub channels. */
#define CLIENT_TYPE_MASTER 3 /* Master. */
#define CLIENT_TYPE_COUNT 4 /* Total number of client types. */
#define CLIENT_TYPE_OBUF_COUNT 3 /* Number of clients to expose to output
buffer configuration. Just the first
three: normal, slave, pubsub. */
@@ -335,7 +342,7 @@ typedef long long ustime_t; /* microsecond time type. */
/* Anti-warning macro... */
#define UNUSED(V) ((void) V)
#define ZSKIPLIST_MAXLEVEL 64 /* Should be enough for 2^64 elements */
#define ZSKIPLIST_MAXLEVEL 32 /* Should be enough for 2^64 elements */
#define ZSKIPLIST_P 0.25 /* Skiplist P = 1/4 */
/* Append only defines */
@@ -389,6 +396,8 @@ typedef long long ustime_t; /* microsecond time type. */
#define CMD_CALL_PROPAGATE_REPL (1<<3)
#define CMD_CALL_PROPAGATE (CMD_CALL_PROPAGATE_AOF|CMD_CALL_PROPAGATE_REPL)
#define CMD_CALL_FULL (CMD_CALL_SLOWLOG | CMD_CALL_STATS | CMD_CALL_PROPAGATE)
#define CMD_CALL_NOWRAP (1<<4) /* Don't wrap also propagate array into
MULTI/EXEC: the caller will handle it. */
/* Command propagation flags, see propagate() function */
#define PROPAGATE_NONE 0
@@ -413,8 +422,8 @@ typedef long long ustime_t; /* microsecond time type. */
#define NOTIFY_EXPIRED (1<<8) /* x */
#define NOTIFY_EVICTED (1<<9) /* e */
#define NOTIFY_STREAM (1<<10) /* t */
#define NOTIFY_KEY_MISS (1<<11) /* m */
#define NOTIFY_ALL (NOTIFY_GENERIC | NOTIFY_STRING | NOTIFY_LIST | NOTIFY_SET | NOTIFY_HASH | NOTIFY_ZSET | NOTIFY_EXPIRED | NOTIFY_EVICTED | NOTIFY_STREAM | NOTIFY_KEY_MISS) /* A flag */
#define NOTIFY_KEY_MISS (1<<11) /* m (Note: This one is excluded from NOTIFY_ALL on purpose) */
#define NOTIFY_ALL (NOTIFY_GENERIC | NOTIFY_STRING | NOTIFY_LIST | NOTIFY_SET | NOTIFY_HASH | NOTIFY_ZSET | NOTIFY_EXPIRED | NOTIFY_EVICTED | NOTIFY_STREAM) /* A flag */
/* Get the first bind addr or NULL */
#define NET_FIRST_BIND_ADDR (server.bindaddr_count ? server.bindaddr[0] : NULL)
@@ -588,7 +597,9 @@ typedef struct RedisModuleDigest {
#define LRU_CLOCK_MAX ((1<<LRU_BITS)-1) /* Max value of obj->lru */
#define LRU_CLOCK_RESOLUTION 1000 /* LRU clock resolution in ms */
#define OBJ_SHARED_REFCOUNT INT_MAX
#define OBJ_SHARED_REFCOUNT INT_MAX /* Global object never destroyed. */
#define OBJ_STATIC_REFCOUNT (INT_MAX-1) /* Object allocated in the stack. */
#define OBJ_FIRST_SPECIAL_REFCOUNT OBJ_STATIC_REFCOUNT
typedef struct redisObject {
unsigned type:4;
unsigned encoding:4;
@@ -609,7 +620,7 @@ char *getObjectTypeName(robj*);
* we'll update it when the structure is changed, to avoid bugs like
* bug #85 introduced exactly in this way. */
#define initStaticStringObject(_var,_ptr) do { \
_var.refcount = 1; \
_var.refcount = OBJ_STATIC_REFCOUNT; \
_var.type = OBJ_STRING; \
_var.encoding = OBJ_ENCODING_RAW; \
_var.ptr = _ptr; \
@@ -812,17 +823,26 @@ typedef struct client {
* when the authenticated user
* changes. */
void *auth_callback_privdata; /* Private data that is passed when the auth
* changed callback is executed. Opaque for
* changed callback is executed. Opaque for
* Redis Core. */
void *auth_module; /* The module that owns the callback, which is used
* to disconnect the client if the module is
* to disconnect the client if the module is
* unloaded for cleanup. Opaque for Redis Core.*/
/* If this client is in tracking mode and this field is non zero,
* invalidation messages for keys fetched by this client will be send to
* the specified client ID. */
uint64_t client_tracking_redirection;
rax *client_tracking_prefixes; /* A dictionary of prefixes we are already
subscribed to in BCAST mode, in the
context of client side caching. */
/* In clientsCronTrackClientsMemUsage() we track the memory usage of
* each client and add it to the sum of all the clients of a given type,
* however we need to remember what was the old contribution of each
* client, and in which categoty the client was, in order to remove it
* before adding it the new value. */
uint64_t client_cron_last_memory_usage;
int client_cron_last_memory_type;
/* Response buffer */
int bufpos;
char buf[PROTO_REPLY_CHUNK_BYTES];
@@ -1060,6 +1080,7 @@ struct redisServer {
list *clients_pending_read; /* Client has pending read socket buffers. */
list *slaves, *monitors; /* List of slaves and MONITORs */
client *current_client; /* Current client executing the command. */
rax *clients_timeout_table; /* Radix tree for blocked clients timeouts. */
long fixed_time_expire; /* If > 0, expire keys against server.mstime. */
rax *clients_index; /* Active clients dictionary by client ID. */
int clients_paused; /* True if clients are currently paused */
@@ -1118,6 +1139,8 @@ struct redisServer {
size_t stat_rdb_cow_bytes; /* Copy on write bytes during RDB saving. */
size_t stat_aof_cow_bytes; /* Copy on write bytes during AOF rewrite. */
size_t stat_module_cow_bytes; /* Copy on write bytes during module fork. */
uint64_t stat_clients_type_memory[CLIENT_TYPE_COUNT];/* Mem usage by type */
long long stat_unexpected_error_replies; /* Number of unexpected (aof-loading, replica to master, etc.) error replies */
/* The following two are used to track instantaneous metrics, like
* number of operations per second, network traffic. */
struct {
@@ -1195,6 +1218,8 @@ struct redisServer {
char *rdb_filename; /* Name of RDB file */
int rdb_compression; /* Use compression in RDB? */
int rdb_checksum; /* Use RDB checksum? */
int rdb_del_sync_files; /* Remove RDB files used only for SYNC if
the instance does not use persistence. */
time_t lastsave; /* Unix time of last successful save */
time_t lastbgsave_try; /* Unix time of last attempted bgsave */
time_t rdb_save_time_last; /* Time used by last RDB save run. */
@@ -1232,6 +1257,7 @@ struct redisServer {
char replid[CONFIG_RUN_ID_SIZE+1]; /* My current replication ID. */
char replid2[CONFIG_RUN_ID_SIZE+1]; /* replid inherited from master*/
long long master_repl_offset; /* My current replication offset */
long long master_repl_meaningful_offset; /* Offset minus latest PINGs. */
long long second_replid_offset; /* Accept offsets up to this for replid2. */
int slaveseldb; /* Last SELECTed DB in replication output */
int repl_ping_slave_period; /* Master pings the slave every N seconds */
@@ -1306,7 +1332,7 @@ struct redisServer {
list *ready_keys; /* List of readyList structures for BLPOP & co */
/* Client side caching. */
unsigned int tracking_clients; /* # of clients with tracking enabled.*/
int tracking_table_max_fill; /* Max fill percentage. */
size_t tracking_table_max_keys; /* Max number of keys in tracking table. */
/* Sort parameters - qsort_r() is only available under BSD so we
* have to take this state global, in order to pass it to sortCompare() */
int sort_desc;
@@ -1334,6 +1360,7 @@ struct redisServer {
/* Pubsub */
dict *pubsub_channels; /* Map channels to list of subscribed clients */
list *pubsub_patterns; /* A list of pubsub_patterns */
dict *pubsub_patterns_dict; /* A dict of pubsub_patterns */
int notify_keyspace_events; /* Events to propagate via Pub/Sub. This is an
xor of NOTIFY_... flags. */
/* Cluster */
@@ -1376,15 +1403,21 @@ struct redisServer {
execution. */
int lua_kill; /* Kill the script if true. */
int lua_always_replicate_commands; /* Default replication type. */
int lua_oom; /* OOM detected when script start? */
/* Lazy free */
int lazyfree_lazy_eviction;
int lazyfree_lazy_expire;
int lazyfree_lazy_server_del;
int lazyfree_lazy_user_del;
/* Latency monitor */
long long latency_monitor_threshold;
dict *latency_events;
/* ACLs */
char *acl_filename; /* ACL Users file. NULL if not configured. */
unsigned long acllog_max_len; /* Maximum length of the ACL LOG list. */
sds requirepass; /* Remember the cleartext password set with the
old "requirepass" directive for backward
compatibility with Redis <= 5. */
/* Assert & bug reporting */
const char *assert_failed;
const char *assert_file;
@@ -1647,13 +1680,15 @@ void addReplyStatusFormat(client *c, const char *fmt, ...);
#endif
/* Client side caching (tracking mode) */
void enableTracking(client *c, uint64_t redirect_to);
void enableTracking(client *c, uint64_t redirect_to, uint64_t options, robj **prefix, size_t numprefix);
void disableTracking(client *c);
void trackingRememberKeys(client *c);
void trackingInvalidateKey(robj *keyobj);
void trackingInvalidateKeysOnFlush(int dbid);
void trackingLimitUsedSlots(void);
unsigned long long trackingGetUsedSlots(void);
uint64_t trackingGetTotalItems(void);
uint64_t trackingGetTotalKeys(void);
void trackingBroadcastInvalidationMessages(void);
/* List data type */
void listTypeTryConversion(robj *subject, robj *value);
@@ -1776,6 +1811,7 @@ void loadingProgress(off_t pos);
void stopLoading(int success);
void startSaving(int rdbflags);
void stopSaving(int success);
int allPersistenceDisabled(void);
#define DISK_ERROR_TYPE_AOF 1 /* Don't accept writes: AOF errors. */
#define DISK_ERROR_TYPE_RDB 2 /* Don't accept writes: RDB errors. */
@@ -1820,11 +1856,12 @@ void ACLInit(void);
#define ACL_OK 0
#define ACL_DENIED_CMD 1
#define ACL_DENIED_KEY 2
#define ACL_DENIED_AUTH 3 /* Only used for ACL LOG entries. */
int ACLCheckUserCredentials(robj *username, robj *password);
int ACLAuthenticateUser(client *c, robj *username, robj *password);
unsigned long ACLGetCommandID(const char *cmdname);
user *ACLGetUserByName(const char *name, size_t namelen);
int ACLCheckCommandPerm(client *c);
int ACLCheckCommandPerm(client *c, int *keyidxptr);
int ACLSetUser(user *u, const char *op, ssize_t oplen);
sds ACLDefaultUserFirstPassword(void);
uint64_t ACLGetCommandCategoryFlagByName(const char *name);
@@ -1836,6 +1873,7 @@ void ACLLoadUsersAtStartup(void);
void addReplyCommandCategories(client *c, struct redisCommand *cmd);
user *ACLCreateUnlinkedUser();
void ACLFreeUserAndKillClients(user *u);
void addACLLogEntry(client *c, int reason, int keypos, sds username);
/* Sorted sets data type */
@@ -2031,8 +2069,9 @@ int objectSetLRUOrLFU(robj *val, long long lfu_freq, long long lru_idle,
#define LOOKUP_NONE 0
#define LOOKUP_NOTOUCH (1<<0)
void dbAdd(redisDb *db, robj *key, robj *val);
int dbAddRDBLoad(redisDb *db, sds key, robj *val);
void dbOverwrite(redisDb *db, robj *key, robj *val);
void genericSetKey(redisDb *db, robj *key, robj *val, int keepttl);
void genericSetKey(redisDb *db, robj *key, robj *val, int keepttl, int signal);
void setKey(redisDb *db, robj *key, robj *val);
int dbExists(redisDb *db, robj *key);
robj *dbRandomKey(redisDb *db);
@@ -2042,6 +2081,7 @@ robj *dbUnshareStringValue(redisDb *db, robj *key, robj *o);
#define EMPTYDB_NO_FLAGS 0 /* No flags. */
#define EMPTYDB_ASYNC (1<<0) /* Reclaim memory in another thread. */
#define EMPTYDB_BACKUP (1<<2) /* DB array is a backup for REPL_DISKLESS_LOAD_SWAPDB. */
long long emptyDb(int dbnum, int flags, void(callback)(void*));
long long emptyDbGeneric(redisDb *dbarray, int dbnum, int flags, void(callback)(void*));
void flushAllDataAndResetRDB(int flags);
@@ -2056,8 +2096,8 @@ unsigned int delKeysInSlot(unsigned int hashslot);
int verifyClusterConfigWithData(void);
void scanGenericCommand(client *c, robj *o, unsigned long cursor);
int parseScanCursorOrReply(client *c, robj *o, unsigned long *cursor);
void slotToKeyAdd(robj *key);
void slotToKeyDel(robj *key);
void slotToKeyAdd(sds key);
void slotToKeyDel(sds key);
void slotToKeyFlush(void);
int dbAsyncDelete(redisDb *db, robj *key);
void emptyDbAsync(redisDb *db);
@@ -2074,6 +2114,8 @@ int *sortGetKeys(struct redisCommand *cmd, robj **argv, int argc, int *numkeys);
int *migrateGetKeys(struct redisCommand *cmd, robj **argv, int argc, int *numkeys);
int *georadiusGetKeys(struct redisCommand *cmd, robj **argv, int argc, int *numkeys);
int *xreadGetKeys(struct redisCommand *cmd, robj **argv, int argc, int *numkeys);
int *memoryGetKeys(struct redisCommand *cmd, robj **argv, int argc, int *numkeys);
int *lcsGetKeys(struct redisCommand *cmd, robj **argv, int argc, int *numkeys);
/* Cluster */
void clusterInit(void);
@@ -2116,6 +2158,12 @@ void handleClientsBlockedOnKeys(void);
void signalKeyAsReady(redisDb *db, robj *key);
void blockForKeys(client *c, int btype, robj **keys, int numkeys, mstime_t timeout, robj *target, streamID *ids);
/* timeout.c -- Blocked clients timeout and connections timeout. */
void addClientToTimeoutTable(client *c);
void removeClientFromTimeoutTable(client *c);
void handleBlockedClientsTimeout(void);
int clientsCronHandleTimeout(client *c, mstime_t now_ms);
/* expire.c -- Handling of expired keys */
void activeExpireCycle(int type);
void expireSlaveKeys(void);
@@ -2157,6 +2205,7 @@ void existsCommand(client *c);
void setbitCommand(client *c);
void getbitCommand(client *c);
void bitfieldCommand(client *c);
void bitfieldroCommand(client *c);
void setrangeCommand(client *c);
void getrangeCommand(client *c);
void incrCommand(client *c);
@@ -2338,6 +2387,7 @@ void xdelCommand(client *c);
void xtrimCommand(client *c);
void lolwutCommand(client *c);
void aclCommand(client *c);
void lcsCommand(client *c);
#if defined(__GNUC__)
void *calloc(size_t count, size_t size) __attribute__ ((deprecated));
@@ -2373,4 +2423,6 @@ int tlsConfigure(redisTLSContextConfig *ctx_config);
#define redisDebugMark() \
printf("-- MARK %s:%d --\n", __FILE__, __LINE__)
int iAmMaster(void);
#endif
+1
View File
@@ -111,5 +111,6 @@ streamNACK *streamCreateNACK(streamConsumer *consumer);
void streamDecodeID(void *buf, streamID *id);
int streamCompareID(streamID *a, streamID *b);
void streamFreeNACK(streamNACK *na);
void streamIncrID(streamID *id);
#endif
+1 -1
View File
@@ -415,7 +415,7 @@ void spopWithCountCommand(client *c) {
/* Make sure a key with the name inputted exists, and that it's type is
* indeed a set. Otherwise, return nil */
if ((set = lookupKeyWriteOrReply(c,c->argv[1],shared.null[c->resp]))
if ((set = lookupKeyWriteOrReply(c,c->argv[1],shared.emptyset[c->resp]))
== NULL || checkType(c,set,OBJ_SET)) return;
/* If count is zero, serve an empty set ASAP to avoid special
+71 -22
View File
@@ -73,6 +73,21 @@ unsigned long streamLength(const robj *subject) {
return s->length;
}
/* Set 'id' to be its successor streamID */
void streamIncrID(streamID *id) {
if (id->seq == UINT64_MAX) {
if (id->ms == UINT64_MAX) {
/* Special case where 'id' is the last possible streamID... */
id->ms = id->seq = 0;
} else {
id->ms++;
id->seq = 0;
}
} else {
id->seq++;
}
}
/* Generate the next stream item ID given the previous one. If the current
* milliseconds Unix time is greater than the previous one, just use this
* as time part and start with sequence part of zero. Otherwise we use the
@@ -83,8 +98,8 @@ void streamNextID(streamID *last_id, streamID *new_id) {
new_id->ms = ms;
new_id->seq = 0;
} else {
new_id->ms = last_id->ms;
new_id->seq = last_id->seq+1;
*new_id = *last_id;
streamIncrID(new_id);
}
}
@@ -782,6 +797,16 @@ int streamDeleteItem(stream *s, streamID *id) {
return deleted;
}
/* Get the last valid (non-tombstone) streamID of 's'. */
void streamLastValidID(stream *s, streamID *maxid)
{
streamIterator si;
streamIteratorStart(&si,s,NULL,NULL,1);
int64_t numfields;
streamIteratorGetID(&si,maxid,&numfields);
streamIteratorStop(&si);
}
/* Emit a reply in the client output buffer by formatting a Stream ID
* in the standard <ms>-<seq> format, using the simple string protocol
* of REPL. */
@@ -823,7 +848,7 @@ void streamPropagateXCLAIM(client *c, robj *key, streamCG *group, robj *groupnam
argv[11] = createStringObject("JUSTID",6);
argv[12] = createStringObject("LASTID",6);
argv[13] = createObjectFromStreamID(&group->last_id);
propagate(server.xclaimCommand,c->db->id,argv,14,PROPAGATE_AOF|PROPAGATE_REPL);
alsoPropagate(server.xclaimCommand,c->db->id,argv,14,PROPAGATE_AOF|PROPAGATE_REPL);
decrRefCount(argv[0]);
decrRefCount(argv[3]);
decrRefCount(argv[4]);
@@ -850,7 +875,7 @@ void streamPropagateGroupID(client *c, robj *key, streamCG *group, robj *groupna
argv[2] = key;
argv[3] = groupname;
argv[4] = createObjectFromStreamID(&group->last_id);
propagate(server.xgroupCommand,c->db->id,argv,5,PROPAGATE_AOF|PROPAGATE_REPL);
alsoPropagate(server.xgroupCommand,c->db->id,argv,5,PROPAGATE_AOF|PROPAGATE_REPL);
decrRefCount(argv[0]);
decrRefCount(argv[1]);
decrRefCount(argv[4]);
@@ -910,7 +935,6 @@ size_t streamReplyWithRange(client *c, stream *s, streamID *start, streamID *end
streamIterator si;
int64_t numfields;
streamID id;
int propagate_last_id = 0;
/* If the client is asking for some history, we serve it using a
* different function, so that we return entries *solely* from its
@@ -926,6 +950,8 @@ size_t streamReplyWithRange(client *c, stream *s, streamID *start, streamID *end
arraylen_ptr = addReplyDeferredLen(c);
streamIteratorStart(&si,s,start,end,rev);
while(streamIteratorGetID(&si,&id,&numfields)) {
int propagate_last_id = 0;
/* Update the group last_id if needed. */
if (group && streamCompareID(&id,&group->last_id) > 0) {
group->last_id = id;
@@ -1043,9 +1069,7 @@ size_t streamReplyWithRangeFromConsumerPEL(client *c, stream *s, streamID *start
* by the user by other means. In that case we signal it emitting
* the ID but then a NULL entry for the fields. */
addReplyArrayLen(c,2);
streamID id;
streamDecodeID(ri.key,&id);
addReplyStreamID(c,&id);
addReplyStreamID(c,&thisid);
addReplyNullArray(c);
} else {
streamNACK *nack = ri.data;
@@ -1220,6 +1244,13 @@ void xaddCommand(client *c) {
if ((o = streamTypeLookupWriteOrCreate(c,c->argv[1])) == NULL) return;
s = o->ptr;
/* Return ASAP if the stream has reached the last possible ID */
if (s->last_id.ms == UINT64_MAX && s->last_id.seq == UINT64_MAX) {
addReplyError(c,"The stream has exhausted the last possible ID, "
"unable to add more items");
return;
}
/* Append using the low level function and return the ID. */
if (streamAppendItem(s,c->argv+field_pos,(c->argc-field_pos)/2,
&id, id_given ? &id : NULL)
@@ -1343,6 +1374,11 @@ void xreadCommand(client *c) {
int moreargs = c->argc-i-1;
char *o = c->argv[i]->ptr;
if (!strcasecmp(o,"BLOCK") && moreargs) {
if (c->flags & CLIENT_LUA) {
/* There is no sense to use BLOCK option within LUA */
addReplyErrorFormat(c, "%s command is not allowed with BLOCK option from scripts", (char *)c->argv[0]->ptr);
return;
}
i++;
if (getTimeoutFromObjectOrReply(c,c->argv[i],&timeout,
UNIT_MILLISECONDS) != C_OK) return;
@@ -1484,20 +1520,23 @@ void xreadCommand(client *c) {
{
serve_synchronously = 1;
serve_history = 1;
} else {
} else if (s->length) {
/* We also want to serve a consumer in a consumer group
* synchronously in case the group top item delivered is smaller
* than what the stream has inside. */
streamID *last = &groups[i]->last_id;
if (s->length && (streamCompareID(&s->last_id, last) > 0)) {
streamID maxid, *last = &groups[i]->last_id;
streamLastValidID(s, &maxid);
if (streamCompareID(&maxid, last) > 0) {
serve_synchronously = 1;
*gt = *last;
}
}
} else {
} else if (s->length) {
/* For consumers without a group, we serve synchronously if we can
* actually provide at least one item from the stream. */
if (s->length && (streamCompareID(&s->last_id, gt) > 0)) {
streamID maxid;
streamLastValidID(s, &maxid);
if (streamCompareID(&maxid, gt) > 0) {
serve_synchronously = 1;
}
}
@@ -1509,7 +1548,7 @@ void xreadCommand(client *c) {
* so start from the next ID, since we want only messages with
* IDs greater than start. */
streamID start = *gt;
start.seq++; /* uint64_t can't overflow in this context. */
streamIncrID(&start);
/* Emit the two elements sub-array consisting of the name
* of the stream and the data we extracted from it. */
@@ -1815,6 +1854,8 @@ NULL
server.dirty++;
notifyKeyspaceEvent(NOTIFY_STREAM,"xgroup-destroy",
c->argv[2],c->db->id);
/* We want to unblock any XREADGROUP consumers with -NOGROUP. */
signalKeyAsReady(c->db,c->argv[2]);
} else {
addReply(c,shared.czero);
}
@@ -1849,11 +1890,7 @@ void xsetidCommand(client *c) {
* item, otherwise the fundamental ID monotonicity assumption is violated. */
if (s->length > 0) {
streamID maxid;
streamIterator si;
streamIteratorStart(&si,s,NULL,NULL,1);
int64_t numfields;
streamIteratorGetID(&si,&maxid,&numfields);
streamIteratorStop(&si);
streamLastValidID(s,&maxid);
if (streamCompareID(&id,&maxid) < 0) {
addReplyError(c,"The ID specified in XSETID is smaller than the "
@@ -1890,11 +1927,21 @@ void xackCommand(client *c) {
return;
}
/* Start parsing the IDs, so that we abort ASAP if there is a syntax
* error: the return value of this command cannot be an error in case
* the client successfully acknowledged some messages, so it should be
* executed in a "all or nothing" fashion. */
for (int j = 3; j < c->argc; j++) {
streamID id;
if (streamParseStrictIDOrReply(c,c->argv[j],&id,0) != C_OK) return;
}
int acknowledged = 0;
for (int j = 3; j < c->argc; j++) {
streamID id;
unsigned char buf[sizeof(streamID)];
if (streamParseStrictIDOrReply(c,c->argv[j],&id,0) != C_OK) return;
if (streamParseStrictIDOrReply(c,c->argv[j],&id,0) != C_OK)
serverPanic("StreamID invalid after check. Should not be possible.");
streamEncodeID(buf,&id);
/* Lookup the ID in the group PEL: it will have a reference to the
@@ -2224,7 +2271,7 @@ void xclaimCommand(client *c) {
}
/* Do the actual claiming. */
streamConsumer *consumer = streamLookupConsumer(group,c->argv[3]->ptr,1);
streamConsumer *consumer = NULL;
void *arraylenptr = addReplyDeferredLen(c);
size_t arraylen = 0;
for (int j = 5; j <= last_id_arg; j++) {
@@ -2276,9 +2323,11 @@ void xclaimCommand(client *c) {
if (nack->consumer)
raxRemove(nack->consumer->pel,buf,sizeof(buf),NULL);
/* Update the consumer and idle time. */
if (consumer == NULL)
consumer = streamLookupConsumer(group,c->argv[3]->ptr,1);
nack->consumer = consumer;
nack->delivery_time = deliverytime;
/* Set the delivery attempts counter if given, otherwise
/* Set the delivery attempts counter if given, otherwise
* autoincrement unless JUSTID option provided */
if (retrycount >= 0) {
nack->delivery_count = retrycount;
+205 -1
View File
@@ -84,7 +84,7 @@ void setGenericCommand(client *c, int flags, robj *key, robj *val, robj *expire,
addReply(c, abort_reply ? abort_reply : shared.null[c->resp]);
return;
}
genericSetKey(c->db,key,val,flags & OBJ_SET_KEEPTTL);
genericSetKey(c->db,key,val,flags & OBJ_SET_KEEPTTL,1);
server.dirty++;
if (expire) setExpire(c,c->db,key,mstime()+milliseconds);
notifyKeyspaceEvent(NOTIFY_STRING,"set",key,c->db->id);
@@ -479,3 +479,207 @@ void strlenCommand(client *c) {
checkType(c,o,OBJ_STRING)) return;
addReplyLongLong(c,stringObjectLen(o));
}
/* LCS -- Longest common subsequence.
*
* LCS [IDX] [MINMATCHLEN <len>]
* STRINGS <string> <string> | KEYS <keya> <keyb> */
void lcsCommand(client *c) {
uint32_t i, j;
long long minmatchlen = 0;
sds a = NULL, b = NULL;
int getlen = 0, getidx = 0, withmatchlen = 0;
robj *obja = NULL, *objb = NULL;
for (j = 1; j < (uint32_t)c->argc; j++) {
char *opt = c->argv[j]->ptr;
int moreargs = (c->argc-1) - j;
if (!strcasecmp(opt,"IDX")) {
getidx = 1;
} else if (!strcasecmp(opt,"LEN")) {
getlen = 1;
} else if (!strcasecmp(opt,"WITHMATCHLEN")) {
withmatchlen = 1;
} else if (!strcasecmp(opt,"MINMATCHLEN") && moreargs) {
if (getLongLongFromObjectOrReply(c,c->argv[j+1],&minmatchlen,NULL)
!= C_OK) return;
if (minmatchlen < 0) minmatchlen = 0;
j++;
} else if (!strcasecmp(opt,"STRINGS")) {
if (a != NULL) {
addReplyError(c,"Either use STRINGS or KEYS");
return;
}
a = c->argv[j+1]->ptr;
b = c->argv[j+2]->ptr;
j += 2;
} else if (!strcasecmp(opt,"KEYS")) {
if (a != NULL) {
addReplyError(c,"Either use STRINGS or KEYS");
return;
}
obja = lookupKeyRead(c->db,c->argv[j+1]);
objb = lookupKeyRead(c->db,c->argv[j+2]);
obja = obja ? getDecodedObject(obja) : createStringObject("",0);
objb = objb ? getDecodedObject(objb) : createStringObject("",0);
a = obja->ptr;
b = objb->ptr;
j += 2;
} else {
addReply(c,shared.syntaxerr);
return;
}
}
/* Complain if the user passed ambiguous parameters. */
if (a == NULL) {
addReplyError(c,"Please specify two strings: "
"STRINGS or KEYS options are mandatory");
return;
} else if (getlen && getidx) {
addReplyError(c,
"If you want both the length and indexes, please "
"just use IDX.");
return;
}
/* Compute the LCS using the vanilla dynamic programming technique of
* building a table of LCS(x,y) substrings. */
uint32_t alen = sdslen(a);
uint32_t blen = sdslen(b);
/* Setup an uint32_t array to store at LCS[i,j] the length of the
* LCS A0..i-1, B0..j-1. Note that we have a linear array here, so
* we index it as LCS[j+(blen+1)*j] */
uint32_t *lcs = zmalloc((alen+1)*(blen+1)*sizeof(uint32_t));
#define LCS(A,B) lcs[(B)+((A)*(blen+1))]
/* Start building the LCS table. */
for (uint32_t i = 0; i <= alen; i++) {
for (uint32_t j = 0; j <= blen; j++) {
if (i == 0 || j == 0) {
/* If one substring has length of zero, the
* LCS length is zero. */
LCS(i,j) = 0;
} else if (a[i-1] == b[j-1]) {
/* The len LCS (and the LCS itself) of two
* sequences with the same final character, is the
* LCS of the two sequences without the last char
* plus that last char. */
LCS(i,j) = LCS(i-1,j-1)+1;
} else {
/* If the last character is different, take the longest
* between the LCS of the first string and the second
* minus the last char, and the reverse. */
uint32_t lcs1 = LCS(i-1,j);
uint32_t lcs2 = LCS(i,j-1);
LCS(i,j) = lcs1 > lcs2 ? lcs1 : lcs2;
}
}
}
/* Store the actual LCS string in "result" if needed. We create
* it backward, but the length is already known, we store it into idx. */
uint32_t idx = LCS(alen,blen);
sds result = NULL; /* Resulting LCS string. */
void *arraylenptr = NULL; /* Deffered length of the array for IDX. */
uint32_t arange_start = alen, /* alen signals that values are not set. */
arange_end = 0,
brange_start = 0,
brange_end = 0;
/* Do we need to compute the actual LCS string? Allocate it in that case. */
int computelcs = getidx || !getlen;
if (computelcs) result = sdsnewlen(SDS_NOINIT,idx);
/* Start with a deferred array if we have to emit the ranges. */
uint32_t arraylen = 0; /* Number of ranges emitted in the array. */
if (getidx) {
addReplyMapLen(c,2);
addReplyBulkCString(c,"matches");
arraylenptr = addReplyDeferredLen(c);
}
i = alen, j = blen;
while (computelcs && i > 0 && j > 0) {
int emit_range = 0;
if (a[i-1] == b[j-1]) {
/* If there is a match, store the character and reduce
* the indexes to look for a new match. */
result[idx-1] = a[i-1];
/* Track the current range. */
if (arange_start == alen) {
arange_start = i-1;
arange_end = i-1;
brange_start = j-1;
brange_end = j-1;
} else {
/* Let's see if we can extend the range backward since
* it is contiguous. */
if (arange_start == i && brange_start == j) {
arange_start--;
brange_start--;
} else {
emit_range = 1;
}
}
/* Emit the range if we matched with the first byte of
* one of the two strings. We'll exit the loop ASAP. */
if (arange_start == 0 || brange_start == 0) emit_range = 1;
idx--; i--; j--;
} else {
/* Otherwise reduce i and j depending on the largest
* LCS between, to understand what direction we need to go. */
uint32_t lcs1 = LCS(i-1,j);
uint32_t lcs2 = LCS(i,j-1);
if (lcs1 > lcs2)
i--;
else
j--;
if (arange_start != alen) emit_range = 1;
}
/* Emit the current range if needed. */
uint32_t match_len = arange_end - arange_start + 1;
if (emit_range) {
if (minmatchlen == 0 || match_len >= minmatchlen) {
if (arraylenptr) {
addReplyArrayLen(c,2+withmatchlen);
addReplyArrayLen(c,2);
addReplyLongLong(c,arange_start);
addReplyLongLong(c,arange_end);
addReplyArrayLen(c,2);
addReplyLongLong(c,brange_start);
addReplyLongLong(c,brange_end);
if (withmatchlen) addReplyLongLong(c,match_len);
arraylen++;
}
}
arange_start = alen; /* Restart at the next match. */
}
}
/* Signal modified key, increment dirty, ... */
/* Reply depending on the given options. */
if (arraylenptr) {
addReplyBulkCString(c,"len");
addReplyLongLong(c,LCS(alen,blen));
setDeferredArrayLen(c,arraylenptr,arraylen);
} else if (getlen) {
addReplyLongLong(c,LCS(alen,blen));
} else {
addReplyBulkSds(c,result);
result = NULL;
}
/* Cleanup. */
if (obja) decrRefCount(obja);
if (objb) decrRefCount(objb);
sdsfree(result);
zfree(lcs);
return;
}
+189
View File
@@ -0,0 +1,189 @@
/* Copyright (c) 2009-2020, Salvatore Sanfilippo <antirez at gmail dot com>
* All rights reserved.
*
* Redistribution and use in source and binary forms, with or without
* modification, are permitted provided that the following conditions are met:
*
* * Redistributions of source code must retain the above copyright notice,
* this list of conditions and the following disclaimer.
* * Redistributions in binary form must reproduce the above copyright
* notice, this list of conditions and the following disclaimer in the
* documentation and/or other materials provided with the distribution.
* * Neither the name of Redis nor the names of its contributors may be used
* to endorse or promote products derived from this software without
* specific prior written permission.
*
* THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS "AS IS"
* AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
* IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
* ARE DISCLAIMED. IN NO EVENT SHALL THE COPYRIGHT OWNER OR CONTRIBUTORS BE
* LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR
* CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF
* SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS
* INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN
* CONTRACT, STRICT LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE)
* ARISING IN ANY WAY OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE
* POSSIBILITY OF SUCH DAMAGE.
*/
#include "server.h"
#include "cluster.h"
/* ========================== Clients timeouts ============================= */
/* Check if this blocked client timedout (does nothing if the client is
* not blocked right now). If so send a reply, unblock it, and return 1.
* Otherwise 0 is returned and no operation is performed. */
int checkBlockedClientTimeout(client *c, mstime_t now) {
if (c->flags & CLIENT_BLOCKED &&
c->bpop.timeout != 0
&& c->bpop.timeout < now)
{
/* Handle blocking operation specific timeout. */
replyToBlockedClientTimedOut(c);
unblockClient(c);
return 1;
} else {
return 0;
}
}
/* Check for timeouts. Returns non-zero if the client was terminated.
* The function gets the current time in milliseconds as argument since
* it gets called multiple times in a loop, so calling gettimeofday() for
* each iteration would be costly without any actual gain. */
int clientsCronHandleTimeout(client *c, mstime_t now_ms) {
time_t now = now_ms/1000;
if (server.maxidletime &&
/* This handles the idle clients connection timeout if set. */
!(c->flags & CLIENT_SLAVE) && /* No timeout for slaves and monitors */
!(c->flags & CLIENT_MASTER) && /* No timeout for masters */
!(c->flags & CLIENT_BLOCKED) && /* No timeout for BLPOP */
!(c->flags & CLIENT_PUBSUB) && /* No timeout for Pub/Sub clients */
(now - c->lastinteraction > server.maxidletime))
{
serverLog(LL_VERBOSE,"Closing idle client");
freeClient(c);
return 1;
} else if (c->flags & CLIENT_BLOCKED) {
/* Cluster: handle unblock & redirect of clients blocked
* into keys no longer served by this server. */
if (server.cluster_enabled) {
if (clusterRedirectBlockedClientIfNeeded(c))
unblockClient(c);
}
}
return 0;
}
/* For blocked clients timeouts we populate a radix tree of 128 bit keys
* composed as such:
*
* [8 byte big endian expire time]+[8 byte client ID]
*
* We don't do any cleanup in the Radix tree: when we run the clients that
* reached the timeout already, if they are no longer existing or no longer
* blocked with such timeout, we just go forward.
*
* Every time a client blocks with a timeout, we add the client in
* the tree. In beforeSleep() we call handleBlockedClientsTimeout() to run
* the tree and unblock the clients. */
#define CLIENT_ST_KEYLEN 16 /* 8 bytes mstime + 8 bytes client ID. */
/* Given client ID and timeout, write the resulting radix tree key in buf. */
void encodeTimeoutKey(unsigned char *buf, uint64_t timeout, client *c) {
timeout = htonu64(timeout);
memcpy(buf,&timeout,sizeof(timeout));
memcpy(buf+8,&c,sizeof(c));
if (sizeof(c) == 4) memset(buf+12,0,4); /* Zero padding for 32bit target. */
}
/* Given a key encoded with encodeTimeoutKey(), resolve the fields and write
* the timeout into *toptr and the client pointer into *cptr. */
void decodeTimeoutKey(unsigned char *buf, uint64_t *toptr, client **cptr) {
memcpy(toptr,buf,sizeof(*toptr));
*toptr = ntohu64(*toptr);
memcpy(cptr,buf+8,sizeof(*cptr));
}
/* Add the specified client id / timeout as a key in the radix tree we use
* to handle blocked clients timeouts. The client is not added to the list
* if its timeout is zero (block forever). */
void addClientToTimeoutTable(client *c) {
if (c->bpop.timeout == 0) return;
uint64_t timeout = c->bpop.timeout;
unsigned char buf[CLIENT_ST_KEYLEN];
encodeTimeoutKey(buf,timeout,c);
if (raxTryInsert(server.clients_timeout_table,buf,sizeof(buf),NULL,NULL))
c->flags |= CLIENT_IN_TO_TABLE;
}
/* Remove the client from the table when it is unblocked for reasons
* different than timing out. */
void removeClientFromTimeoutTable(client *c) {
if (!(c->flags & CLIENT_IN_TO_TABLE)) return;
c->flags &= ~CLIENT_IN_TO_TABLE;
uint64_t timeout = c->bpop.timeout;
unsigned char buf[CLIENT_ST_KEYLEN];
encodeTimeoutKey(buf,timeout,c);
raxRemove(server.clients_timeout_table,buf,sizeof(buf),NULL);
}
/* This function is called in beforeSleep() in order to unblock clients
* that are waiting in blocking operations with a timeout set. */
void handleBlockedClientsTimeout(void) {
if (raxSize(server.clients_timeout_table) == 0) return;
uint64_t now = mstime();
raxIterator ri;
raxStart(&ri,server.clients_timeout_table);
raxSeek(&ri,"^",NULL,0);
while(raxNext(&ri)) {
uint64_t timeout;
client *c;
decodeTimeoutKey(ri.key,&timeout,&c);
if (timeout >= now) break; /* All the timeouts are in the future. */
c->flags &= ~CLIENT_IN_TO_TABLE;
checkBlockedClientTimeout(c,now);
raxRemove(server.clients_timeout_table,ri.key,ri.key_len,NULL);
raxSeek(&ri,"^",NULL,0);
}
}
/* Get a timeout value from an object and store it into 'timeout'.
* The final timeout is always stored as milliseconds as a time where the
* timeout will expire, however the parsing is performed according to
* the 'unit' that can be seconds or milliseconds.
*
* Note that if the timeout is zero (usually from the point of view of
* commands API this means no timeout) the value stored into 'timeout'
* is zero. */
int getTimeoutFromObjectOrReply(client *c, robj *object, mstime_t *timeout, int unit) {
long long tval;
long double ftval;
if (unit == UNIT_SECONDS) {
if (getLongDoubleFromObjectOrReply(c,object,&ftval,
"timeout is not an float or out of range") != C_OK)
return C_ERR;
tval = (long long) (ftval * 1000.0);
} else {
if (getLongLongFromObjectOrReply(c,object,&tval,
"timeout is not an integer or out of range") != C_OK)
return C_ERR;
}
if (tval < 0) {
addReplyError(c,"timeout is negative");
return C_ERR;
}
if (tval > 0) {
tval += mstime();
}
*timeout = tval;
return C_OK;
}
+288 -133
View File
@@ -30,39 +30,34 @@
#include "server.h"
/* The tracking table is constituted by 2^24 radix trees (each tree, and the
* table itself, are allocated in a lazy way only when needed) tracking
* clients that may have certain keys in their local, client side, cache.
*
* Keys are grouped into 2^24 slots, in a way similar to Redis Cluster hash
* slots, however here the function we use is crc64, taking the least
* significant 24 bits of the output.
/* The tracking table is constituted by a radix tree of keys, each pointing
* to a radix tree of client IDs, used to track the clients that may have
* certain keys in their local, client side, cache.
*
* When a client enables tracking with "CLIENT TRACKING on", each key served to
* the client is hashed to one of such slots, and Redis will remember what
* client may have keys about such slot. Later, when a key in a given slot is
* modified, all the clients that may have local copies of keys in that slot
* will receive an invalidation message. There is no distinction of database
* number: a single table is used.
* the client is remembered in the table mapping the keys to the client IDs.
* Later, when a key is modified, all the clients that may have local copy
* of such key will receive an invalidation message.
*
* Clients will normally take frequently requested objects in memory, removing
* them when invalidation messages are received. A strategy clients may use is
* to just cache objects in a dictionary, associating to each cached object
* some incremental epoch, or just a timestamp. When invalidation messages are
* received clients may store, in a different table, the timestamp (or epoch)
* of the invalidation of such given slot: later when accessing objects, the
* eviction of stale objects may be performed in a lazy way by checking if the
* cached object timestamp is older than the invalidation timestamp for such
* objects.
*
* The output of the 24 bit hash function is very large (more than 16 million
* possible slots), so clients that may want to use less resources may only
* use the most significant bits instead of the full 24 bits. */
#define TRACKING_TABLE_SIZE (1<<24)
rax **TrackingTable = NULL;
unsigned long TrackingTableUsedSlots = 0;
* them when invalidation messages are received. */
rax *TrackingTable = NULL;
rax *PrefixTable = NULL;
uint64_t TrackingTableTotalItems = 0; /* Total number of IDs stored across
the whole tracking table. This gives
an hint about the total memory we
are using server side for CSC. */
robj *TrackingChannelName;
/* This is the structure that we have as value of the PrefixTable, and
* represents the list of keys modified, and the list of clients that need
* to be notified, for a given prefix. */
typedef struct bcastState {
rax *keys; /* Keys modified in the current event loop cycle. */
rax *clients; /* Clients subscribed to the notification events for this
prefix. */
} bcastState;
/* Remove the tracking state from the client 'c'. Note that there is not much
* to do for us here, if not to decrement the counter of the clients in
* tracking mode, because we just store the ID of the client in the tracking
@@ -70,9 +65,56 @@ robj *TrackingChannelName;
* client with many entries in the table is removed, it would cost a lot of
* time to do the cleanup. */
void disableTracking(client *c) {
/* If this client is in broadcasting mode, we need to unsubscribe it
* from all the prefixes it is registered to. */
if (c->flags & CLIENT_TRACKING_BCAST) {
raxIterator ri;
raxStart(&ri,c->client_tracking_prefixes);
raxSeek(&ri,"^",NULL,0);
while(raxNext(&ri)) {
bcastState *bs = raxFind(PrefixTable,ri.key,ri.key_len);
serverAssert(bs != raxNotFound);
raxRemove(bs->clients,(unsigned char*)&c,sizeof(c),NULL);
/* Was it the last client? Remove the prefix from the
* table. */
if (raxSize(bs->clients) == 0) {
raxFree(bs->clients);
raxFree(bs->keys);
zfree(bs);
raxRemove(PrefixTable,ri.key,ri.key_len,NULL);
}
}
raxStop(&ri);
raxFree(c->client_tracking_prefixes);
c->client_tracking_prefixes = NULL;
}
/* Clear flags and adjust the count. */
if (c->flags & CLIENT_TRACKING) {
server.tracking_clients--;
c->flags &= ~(CLIENT_TRACKING|CLIENT_TRACKING_BROKEN_REDIR);
c->flags &= ~(CLIENT_TRACKING|CLIENT_TRACKING_BROKEN_REDIR|
CLIENT_TRACKING_BCAST|CLIENT_TRACKING_OPTIN|
CLIENT_TRACKING_OPTOUT|CLIENT_TRACKING_CACHING);
}
}
/* Set the client 'c' to track the prefix 'prefix'. If the client 'c' is
* already registered for the specified prefix, no operation is performed. */
void enableBcastTrackingForPrefix(client *c, char *prefix, size_t plen) {
bcastState *bs = raxFind(PrefixTable,(unsigned char*)prefix,sdslen(prefix));
/* If this is the first client subscribing to such prefix, create
* the prefix in the table. */
if (bs == raxNotFound) {
bs = zmalloc(sizeof(*bs));
bs->keys = raxNew();
bs->clients = raxNew();
raxInsert(PrefixTable,(unsigned char*)prefix,plen,bs,NULL);
}
if (raxTryInsert(bs->clients,(unsigned char*)&c,sizeof(c),NULL,NULL)) {
if (c->client_tracking_prefixes == NULL)
c->client_tracking_prefixes = raxNew();
raxInsert(c->client_tracking_prefixes,
(unsigned char*)prefix,plen,NULL,NULL);
}
}
@@ -83,24 +125,43 @@ void disableTracking(client *c) {
* eventually get freed, we'll send a message to the original client to
* inform it of the condition. Multiple clients can redirect the invalidation
* messages to the same client ID. */
void enableTracking(client *c, uint64_t redirect_to) {
if (c->flags & CLIENT_TRACKING) return;
void enableTracking(client *c, uint64_t redirect_to, uint64_t options, robj **prefix, size_t numprefix) {
if (!(c->flags & CLIENT_TRACKING)) server.tracking_clients++;
c->flags |= CLIENT_TRACKING;
c->flags &= ~CLIENT_TRACKING_BROKEN_REDIR;
c->flags &= ~(CLIENT_TRACKING_BROKEN_REDIR|CLIENT_TRACKING_BCAST|
CLIENT_TRACKING_OPTIN|CLIENT_TRACKING_OPTOUT);
c->client_tracking_redirection = redirect_to;
server.tracking_clients++;
if (TrackingTable == NULL) {
TrackingTable = zcalloc(sizeof(rax*) * TRACKING_TABLE_SIZE);
TrackingTable = raxNew();
PrefixTable = raxNew();
TrackingChannelName = createStringObject("__redis__:invalidate",20);
}
if (options & CLIENT_TRACKING_BCAST) {
c->flags |= CLIENT_TRACKING_BCAST;
if (numprefix == 0) enableBcastTrackingForPrefix(c,"",0);
for (size_t j = 0; j < numprefix; j++) {
sds sdsprefix = prefix[j]->ptr;
enableBcastTrackingForPrefix(c,sdsprefix,sdslen(sdsprefix));
}
}
c->flags |= options & (CLIENT_TRACKING_OPTIN|CLIENT_TRACKING_OPTOUT);
}
/* This function is called after the excution of a readonly command in the
* case the client 'c' has keys tracking enabled. It will populate the
* tracking ivalidation table according to the keys the user fetched, so that
* Redis will know what are the clients that should receive an invalidation
* message with certain groups of keys are modified. */
/* This function is called after the execution of a readonly command in the
* case the client 'c' has keys tracking enabled and the tracking is not
* in BCAST mode. It will populate the tracking invalidation table according
* to the keys the user fetched, so that Redis will know what are the clients
* that should receive an invalidation message with certain groups of keys
* are modified. */
void trackingRememberKeys(client *c) {
/* Return if we are in optin/out mode and the right CACHING command
* was/wasn't given in order to modify the default behavior. */
uint64_t optin = c->flags & CLIENT_TRACKING_OPTIN;
uint64_t optout = c->flags & CLIENT_TRACKING_OPTOUT;
uint64_t caching_given = c->flags & CLIENT_TRACKING_CACHING;
if ((optin && !caching_given) || (optout && caching_given)) return;
int numkeys;
int *keys = getKeysFromCommand(c->cmd,c->argv,c->argc,&numkeys);
if (keys == NULL) return;
@@ -108,19 +169,30 @@ void trackingRememberKeys(client *c) {
for(int j = 0; j < numkeys; j++) {
int idx = keys[j];
sds sdskey = c->argv[idx]->ptr;
uint64_t hash = crc64(0,
(unsigned char*)sdskey,sdslen(sdskey))&(TRACKING_TABLE_SIZE-1);
if (TrackingTable[hash] == NULL) {
TrackingTable[hash] = raxNew();
TrackingTableUsedSlots++;
rax *ids = raxFind(TrackingTable,(unsigned char*)sdskey,sdslen(sdskey));
if (ids == raxNotFound) {
ids = raxNew();
int inserted = raxTryInsert(TrackingTable,(unsigned char*)sdskey,
sdslen(sdskey),ids, NULL);
serverAssert(inserted == 1);
}
raxTryInsert(TrackingTable[hash],
(unsigned char*)&c->id,sizeof(c->id),NULL,NULL);
if (raxTryInsert(ids,(unsigned char*)&c->id,sizeof(c->id),NULL,NULL))
TrackingTableTotalItems++;
}
getKeysFreeResult(keys);
}
void sendTrackingMessage(client *c, long long hash) {
/* Given a key name, this function sends an invalidation message in the
* proper channel (depending on RESP version: PubSub or Push message) and
* to the proper client (in case fo redirection), in the context of the
* client 'c' with tracking enabled.
*
* In case the 'proto' argument is non zero, the function will assume that
* 'keyname' points to a buffer of 'keylen' bytes already expressed in the
* form of Redis RESP protocol, representing an array of keys to send
* to the client as value of the invalidation. This is used in BCAST mode
* in order to optimized the implementation to use less CPU time. */
void sendTrackingMessage(client *c, char *keyname, size_t keylen, int proto) {
int using_redirection = 0;
if (c->client_tracking_redirection) {
client *redir = lookupClientByID(c->client_tracking_redirection);
@@ -146,36 +218,45 @@ void sendTrackingMessage(client *c, long long hash) {
if (c->resp > 2) {
addReplyPushLen(c,2);
addReplyBulkCBuffer(c,"invalidate",10);
addReplyLongLong(c,hash);
} else if (using_redirection && c->flags & CLIENT_PUBSUB) {
robj *msg = createStringObjectFromLongLong(hash);
addReplyPubsubMessage(c,TrackingChannelName,msg);
decrRefCount(msg);
/* We use a static object to speedup things, however we assume
* that addReplyPubsubMessage() will not take a reference. */
addReplyPubsubMessage(c,TrackingChannelName,NULL);
} else {
/* If are here, the client is not using RESP3, nor is
* redirecting to another client. We can't send anything to
* it since RESP2 does not support push messages in the same
* connection. */
return;
}
/* Send the "value" part, which is the array of keys. */
if (proto) {
addReplyProto(c,keyname,keylen);
} else {
addReplyArrayLen(c,1);
addReplyBulkCBuffer(c,keyname,keylen);
}
}
/* Invalidates a caching slot: this is actually the low level implementation
* of the API that Redis calls externally, that is trackingInvalidateKey(). */
void trackingInvalidateSlot(uint64_t slot) {
if (TrackingTable == NULL || TrackingTable[slot] == NULL) return;
/* This function is called when a key is modified in Redis and in the case
* we have at least one client with the BCAST mode enabled.
* Its goal is to set the key in the right broadcast state if the key
* matches one or more prefixes in the prefix table. Later when we
* return to the event loop, we'll send invalidation messages to the
* clients subscribed to each prefix. */
void trackingRememberKeyToBroadcast(char *keyname, size_t keylen) {
raxIterator ri;
raxStart(&ri,TrackingTable[slot]);
raxStart(&ri,PrefixTable);
raxSeek(&ri,"^",NULL,0);
while(raxNext(&ri)) {
uint64_t id;
memcpy(&id,ri.key,sizeof(id));
client *c = lookupClientByID(id);
if (c == NULL || !(c->flags & CLIENT_TRACKING)) continue;
sendTrackingMessage(c,slot);
if (ri.key_len > keylen) continue;
if (ri.key_len != 0 && memcmp(ri.key,keyname,ri.key_len) != 0)
continue;
bcastState *bs = ri.data;
raxTryInsert(bs->keys,(unsigned char*)keyname,keylen,NULL,NULL);
}
raxStop(&ri);
/* Free the tracking table: we'll create the radix tree and populate it
* again if more keys will be modified in this caching slot. */
raxFree(TrackingTable[slot]);
TrackingTable[slot] = NULL;
TrackingTableUsedSlots--;
}
/* This function is called from signalModifiedKey() or other places in Redis
@@ -183,28 +264,55 @@ void trackingInvalidateSlot(uint64_t slot) {
* to send a notification to every client that may have keys about such caching
* slot. */
void trackingInvalidateKey(robj *keyobj) {
if (TrackingTable == NULL || TrackingTableUsedSlots == 0) return;
if (TrackingTable == NULL) return;
sds sdskey = keyobj->ptr;
uint64_t hash = crc64(0,
(unsigned char*)sdskey,sdslen(sdskey))&(TRACKING_TABLE_SIZE-1);
trackingInvalidateSlot(hash);
if (raxSize(PrefixTable) > 0)
trackingRememberKeyToBroadcast(sdskey,sdslen(sdskey));
rax *ids = raxFind(TrackingTable,(unsigned char*)sdskey,sdslen(sdskey));
if (ids == raxNotFound) return;
raxIterator ri;
raxStart(&ri,ids);
raxSeek(&ri,"^",NULL,0);
while(raxNext(&ri)) {
uint64_t id;
memcpy(&id,ri.key,sizeof(id));
client *c = lookupClientByID(id);
/* Note that if the client is in BCAST mode, we don't want to
* send invalidation messages that were pending in the case
* previously the client was not in BCAST mode. This can happen if
* TRACKING is enabled normally, and then the client switches to
* BCAST mode. */
if (c == NULL ||
!(c->flags & CLIENT_TRACKING)||
c->flags & CLIENT_TRACKING_BCAST)
{
continue;
}
sendTrackingMessage(c,sdskey,sdslen(sdskey),0);
}
raxStop(&ri);
/* Free the tracking table: we'll create the radix tree and populate it
* again if more keys will be modified in this caching slot. */
TrackingTableTotalItems -= raxSize(ids);
raxFree(ids);
raxRemove(TrackingTable,(unsigned char*)sdskey,sdslen(sdskey),NULL);
}
/* This function is called when one or all the Redis databases are flushed
* (dbid == -1 in case of FLUSHALL). Caching slots are not specific for
* each DB but are global: currently what we do is sending a special
* (dbid == -1 in case of FLUSHALL). Caching keys are not specific for
* each DB but are global: currently what we do is send a special
* notification to clients with tracking enabled, invalidating the caching
* slot "-1", which means, "all the keys", in order to avoid flooding clients
* key "", which means, "all the keys", in order to avoid flooding clients
* with many invalidation messages for all the keys they may hold.
*
* However trying to flush the tracking table here is very costly:
* we need scanning 16 million caching slots in the table to check
* if they are used, this introduces a big delay. So what we do is to really
* flush the table in the case of FLUSHALL. When a FLUSHDB is called instead
* we just send the invalidation message to all the clients, but don't
* flush the table: it will slowly get garbage collected as more keys
* are modified in the used caching slots. */
*/
void freeTrackingRadixTree(void *rt) {
raxFree(rt);
}
void trackingInvalidateKeysOnFlush(int dbid) {
if (server.tracking_clients) {
listNode *ln;
@@ -213,84 +321,131 @@ void trackingInvalidateKeysOnFlush(int dbid) {
while ((ln = listNext(&li)) != NULL) {
client *c = listNodeValue(ln);
if (c->flags & CLIENT_TRACKING) {
sendTrackingMessage(c,-1);
sendTrackingMessage(c,"",1,0);
}
}
}
/* In case of FLUSHALL, reclaim all the memory used by tracking. */
if (dbid == -1 && TrackingTable) {
for (int j = 0; j < TRACKING_TABLE_SIZE && TrackingTableUsedSlots > 0; j++) {
if (TrackingTable[j] != NULL) {
raxFree(TrackingTable[j]);
TrackingTable[j] = NULL;
TrackingTableUsedSlots--;
}
}
/* If there are no clients with tracking enabled, we can even
* reclaim the memory used by the table itself. The code assumes
* the table is allocated only if there is at least one client alive
* with tracking enabled. */
if (server.tracking_clients == 0) {
zfree(TrackingTable);
TrackingTable = NULL;
}
raxFreeWithCallback(TrackingTable,freeTrackingRadixTree);
TrackingTable = raxNew();
TrackingTableTotalItems = 0;
}
}
/* Tracking forces Redis to remember information about which client may have
* keys about certian caching slots. In workloads where there are a lot of
* reads, but keys are hardly modified, the amount of information we have
* to remember server side could be a lot: for each 16 millions of caching
* slots we may end with a radix tree containing many entries.
* certain keys. In workloads where there are a lot of reads, but keys are
* hardly modified, the amount of information we have to remember server side
* could be a lot, with the number of keys being totally not bound.
*
* So Redis allows the user to configure a maximum fill rate for the
* So Redis allows the user to configure a maximum number of keys for the
* invalidation table. This function makes sure that we don't go over the
* specified fill rate: if we are over, we can just evict informations about
* random caching slots, and send invalidation messages to clients like if
* the key was modified. */
* a random key, and send invalidation messages to clients like if the key was
* modified. */
void trackingLimitUsedSlots(void) {
static unsigned int timeout_counter = 0;
if (server.tracking_table_max_fill == 0) return; /* No limits set. */
unsigned int max_slots =
(TRACKING_TABLE_SIZE/100) * server.tracking_table_max_fill;
if (TrackingTableUsedSlots <= max_slots) {
if (TrackingTable == NULL) return;
if (server.tracking_table_max_keys == 0) return; /* No limits set. */
size_t max_keys = server.tracking_table_max_keys;
if (raxSize(TrackingTable) <= max_keys) {
timeout_counter = 0;
return; /* Limit not reached. */
}
/* We have to invalidate a few slots to reach the limit again. The effort
/* We have to invalidate a few keys to reach the limit again. The effort
* we do here is proportional to the number of times we entered this
* function and found that we are still over the limit. */
int effort = 100 * (timeout_counter+1);
/* Let's start at a random position, and perform linear probing, in order
* to improve cache locality. However once we are able to find an used
* slot, jump again randomly, in order to avoid creating big holes in the
* table (that will make this funciton use more resourced later). */
/* We just remove one key after another by using a random walk. */
raxIterator ri;
raxStart(&ri,TrackingTable);
while(effort > 0) {
unsigned int idx = rand() % TRACKING_TABLE_SIZE;
do {
effort--;
idx = (idx+1) % TRACKING_TABLE_SIZE;
if (TrackingTable[idx] != NULL) {
trackingInvalidateSlot(idx);
if (TrackingTableUsedSlots <= max_slots) {
timeout_counter = 0;
return; /* Return ASAP: we are again under the limit. */
} else {
break; /* Jump to next random position. */
}
}
} while(effort > 0);
effort--;
raxSeek(&ri,"^",NULL,0);
raxRandomWalk(&ri,0);
rax *ids = ri.data;
TrackingTableTotalItems -= raxSize(ids);
raxFree(ids);
raxRemove(TrackingTable,ri.key,ri.key_len,NULL);
if (raxSize(TrackingTable) <= max_keys) {
timeout_counter = 0;
raxStop(&ri);
return; /* Return ASAP: we are again under the limit. */
}
}
/* If we reach this point, we were not able to go under the configured
* limit using the maximum effort we had for this run. */
raxStop(&ri);
timeout_counter++;
}
/* This function will run the prefixes of clients in BCAST mode and
* keys that were modified about each prefix, and will send the
* notifications to each client in each prefix. */
void trackingBroadcastInvalidationMessages(void) {
raxIterator ri, ri2;
/* Return ASAP if there is nothing to do here. */
if (TrackingTable == NULL || !server.tracking_clients) return;
raxStart(&ri,PrefixTable);
raxSeek(&ri,"^",NULL,0);
while(raxNext(&ri)) {
bcastState *bs = ri.data;
if (raxSize(bs->keys)) {
/* Create the array reply with the list of keys once, then send
* it to all the clients subscribed to this prefix. */
char buf[32];
size_t len = ll2string(buf,sizeof(buf),raxSize(bs->keys));
sds proto = sdsempty();
proto = sdsMakeRoomFor(proto,raxSize(bs->keys)*15);
proto = sdscatlen(proto,"*",1);
proto = sdscatlen(proto,buf,len);
proto = sdscatlen(proto,"\r\n",2);
raxStart(&ri2,bs->keys);
raxSeek(&ri2,"^",NULL,0);
while(raxNext(&ri2)) {
len = ll2string(buf,sizeof(buf),ri2.key_len);
proto = sdscatlen(proto,"$",1);
proto = sdscatlen(proto,buf,len);
proto = sdscatlen(proto,"\r\n",2);
proto = sdscatlen(proto,ri2.key,ri2.key_len);
proto = sdscatlen(proto,"\r\n",2);
}
raxStop(&ri2);
/* Send this array of keys to every client in the list. */
raxStart(&ri2,bs->clients);
raxSeek(&ri2,"^",NULL,0);
while(raxNext(&ri2)) {
client *c;
memcpy(&c,ri2.key,sizeof(c));
sendTrackingMessage(c,proto,sdslen(proto),1);
}
raxStop(&ri2);
/* Clean up: we can remove everything from this state, because we
* want to only track the new keys that will be accumulated starting
* from now. */
sdsfree(proto);
}
raxFree(bs->keys);
bs->keys = raxNew();
}
raxStop(&ri);
}
/* This is just used in order to access the amount of used slots in the
* tracking table. */
unsigned long long trackingGetUsedSlots(void) {
return TrackingTableUsedSlots;
uint64_t trackingGetTotalItems(void) {
return TrackingTableTotalItems;
}
uint64_t trackingGetTotalKeys(void) {
if (TrackingTable == NULL) return 0;
return raxSize(TrackingTable);
}
+6 -1
View File
@@ -471,13 +471,14 @@ int string2ld(const char *s, size_t slen, long double *dp) {
long double value;
char *eptr;
if (slen >= sizeof(buf)) return 0;
if (slen == 0 || slen >= sizeof(buf)) return 0;
memcpy(buf,s,slen);
buf[slen] = '\0';
errno = 0;
value = strtold(buf, &eptr);
if (isspace(buf[0]) || eptr[0] != '\0' ||
(size_t)(eptr-buf) != slen ||
(errno == ERANGE &&
(value == HUGE_VAL || value == -HUGE_VAL || value == 0)) ||
errno == EINVAL ||
@@ -601,6 +602,10 @@ int ld2string(char *buf, size_t len, long double value, ld2string_mode mode) {
}
if (*p == '.') l--;
}
if (l == 2 && buf[0] == '-' && buf[1] == '0') {
buf[0] = '0';
l = 1;
}
break;
default: return 0; /* Invalid mode. */
}
@@ -0,0 +1,87 @@
source "../tests/includes/init-tests.tcl"
test "Create a 5 nodes cluster" {
create_cluster 5 5
}
test "Cluster should start ok" {
assert_cluster_state ok
}
test "Cluster is writable" {
cluster_write_test 0
}
proc find_non_empty_master {} {
set master_id_no {}
foreach_redis_id id {
if {[RI $id role] eq {master} && [R $id dbsize] > 0} {
set master_id_no $id
}
}
return $master_id_no
}
proc get_one_of_my_replica {id} {
set replica_port [lindex [lindex [lindex [R $id role] 2] 0] 1]
set replica_id_num [get_instance_id_by_port redis $replica_port]
return $replica_id_num
}
proc cluster_write_keys_with_expire {id ttl} {
set prefix [randstring 20 20 alpha]
set port [get_instance_attrib redis $id port]
set cluster [redis_cluster 127.0.0.1:$port]
for {set j 100} {$j < 200} {incr j} {
$cluster setex key_expire.$j $ttl $prefix.$j
}
$cluster close
}
proc test_slave_load_expired_keys {aof} {
test "Slave expired keys is loaded when restarted: appendonly=$aof" {
set master_id [find_non_empty_master]
set replica_id [get_one_of_my_replica $master_id]
set master_dbsize [R $master_id dbsize]
set slave_dbsize [R $replica_id dbsize]
assert_equal $master_dbsize $slave_dbsize
set data_ttl 5
cluster_write_keys_with_expire $master_id $data_ttl
after 100
set replica_dbsize_1 [R $replica_id dbsize]
assert {$replica_dbsize_1 > $slave_dbsize}
R $replica_id config set appendonly $aof
R $replica_id config rewrite
set start_time [clock seconds]
set end_time [expr $start_time+$data_ttl+2]
R $replica_id save
set replica_dbsize_2 [R $replica_id dbsize]
assert {$replica_dbsize_2 > $slave_dbsize}
kill_instance redis $replica_id
set master_port [get_instance_attrib redis $master_id port]
exec ../../../src/redis-cli -h 127.0.0.1 -p $master_port debug sleep [expr $data_ttl+3] > /dev/null &
while {[clock seconds] <= $end_time} {
#wait for $data_ttl seconds
}
restart_instance redis $replica_id
wait_for_condition 200 50 {
[R $replica_id ping] eq {PONG}
} else {
fail "replica #$replica_id not started"
}
set replica_dbsize_3 [R $replica_id dbsize]
assert {$replica_dbsize_3 > $slave_dbsize}
}
}
test_slave_load_expired_keys no
after 5000
test_slave_load_expired_keys yes
+61
View File
@@ -0,0 +1,61 @@
# Test the meaningful offset implementation to make sure masters
# are able to PSYNC with replicas even if the replication stream
# has pending PINGs at the end.
start_server {tags {"psync2"}} {
start_server {} {
# Config
set debug_msg 0 ; # Enable additional debug messages
for {set j 0} {$j < 2} {incr j} {
set R($j) [srv [expr 0-$j] client]
set R_host($j) [srv [expr 0-$j] host]
set R_port($j) [srv [expr 0-$j] port]
$R($j) CONFIG SET repl-ping-replica-period 1
if {$debug_msg} {puts "Log file: [srv [expr 0-$j] stdout]"}
}
# Setup replication
test "PSYNC2 meaningful offset: setup" {
$R(1) replicaof $R_host(0) $R_port(0)
$R(0) set foo bar
wait_for_condition 50 1000 {
[$R(0) dbsize] == 1 && [$R(1) dbsize] == 1
} else {
fail "Replicas not replicating from master"
}
}
test "PSYNC2 meaningful offset: write and wait replication" {
$R(0) INCR counter
$R(0) INCR counter
$R(0) INCR counter
wait_for_condition 50 1000 {
[$R(0) GET counter] eq [$R(1) GET counter]
} else {
fail "Master and replica don't agree about counter"
}
}
# In this test we'll make sure the replica will get stuck, but with
# an active connection: this way the master will continue to send PINGs
# every second (we modified the PING period earlier)
test "PSYNC2 meaningful offset: pause replica and promote it" {
$R(1) MULTI
$R(1) DEBUG SLEEP 5
$R(1) SLAVEOF NO ONE
$R(1) EXEC
$R(1) ping ; # Wait for it to return back available
}
test "Make the old master a replica of the new one and check conditions" {
set sync_partial [status $R(1) sync_partial_ok]
assert {$sync_partial == 0}
$R(0) REPLICAOF $R_host(1) $R_port(1)
wait_for_condition 50 1000 {
[status $R(1) sync_partial_ok] == 1
} else {
fail "The new master was not able to partial sync"
}
}
}}
+21
View File
@@ -114,6 +114,27 @@ start_server {} {
}
}
# wait for all the slaves to be in sync with the master
set master_ofs [status $R($master_id) master_repl_offset]
wait_for_condition 500 100 {
$master_ofs == [status $R(0) master_repl_offset] &&
$master_ofs == [status $R(1) master_repl_offset] &&
$master_ofs == [status $R(2) master_repl_offset] &&
$master_ofs == [status $R(3) master_repl_offset] &&
$master_ofs == [status $R(4) master_repl_offset]
} else {
if {$debug_msg} {
for {set j 0} {$j < 5} {incr j} {
puts "$j: sync_full: [status $R($j) sync_full]"
puts "$j: id1 : [status $R($j) master_replid]:[status $R($j) master_repl_offset]"
puts "$j: id2 : [status $R($j) master_replid2]:[status $R($j) second_repl_offset]"
puts "$j: backlog : firstbyte=[status $R($j) repl_backlog_first_byte_offset] len=[status $R($j) repl_backlog_histlen]"
puts "---"
}
}
fail "Slaves are not in sync with the master after too long time."
}
# Put down the old master so that it cannot generate more
# replication stream, this way in the next master switch, the time at
# which we move slaves away is not important, each will have full
+105 -28
View File
@@ -109,41 +109,33 @@ int fsl_push(RedisModuleCtx *ctx, RedisModuleString **argv, int argc) {
return RedisModule_ReplyWithError(ctx,"ERR new element has to be greater than the head element");
fsl->list[fsl->length++] = ele;
if (fsl->length >= 2)
RedisModule_SignalKeyAsReady(ctx, argv[1]);
RedisModule_SignalKeyAsReady(ctx, argv[1]);
return RedisModule_ReplyWithSimpleString(ctx, "OK");
}
int bpop2_reply_callback(RedisModuleCtx *ctx, RedisModuleString **argv, int argc) {
int bpop_reply_callback(RedisModuleCtx *ctx, RedisModuleString **argv, int argc) {
REDISMODULE_NOT_USED(argv);
REDISMODULE_NOT_USED(argc);
RedisModuleString *keyname = RedisModule_GetBlockedClientReadyKey(ctx);
fsl_t *fsl;
if (!get_fsl(ctx, keyname, REDISMODULE_READ, 0, &fsl, 0))
if (!get_fsl(ctx, keyname, REDISMODULE_READ, 0, &fsl, 0) || !fsl)
return REDISMODULE_ERR;
if (!fsl || fsl->length < 2)
return REDISMODULE_ERR;
RedisModule_ReplyWithArray(ctx, 2);
RedisModule_ReplyWithLongLong(ctx, fsl->list[--fsl->length]);
RedisModule_ReplyWithLongLong(ctx, fsl->list[--fsl->length]);
return REDISMODULE_OK;
}
int bpop2_timeout_callback(RedisModuleCtx *ctx, RedisModuleString **argv, int argc) {
int bpop_timeout_callback(RedisModuleCtx *ctx, RedisModuleString **argv, int argc) {
REDISMODULE_NOT_USED(argv);
REDISMODULE_NOT_USED(argc);
return RedisModule_ReplyWithSimpleString(ctx, "Request timedout");
}
/* FSL.BPOP2 <key> <timeout> - Block clients until list has two or more elements.
/* FSL.BPOP <key> <timeout> - Block clients until list has two or more elements.
* When that happens, unblock client and pop the last two elements (from the right). */
int fsl_bpop2(RedisModuleCtx *ctx, RedisModuleString **argv, int argc) {
int fsl_bpop(RedisModuleCtx *ctx, RedisModuleString **argv, int argc) {
if (argc != 3)
return RedisModule_WrongArity(ctx);
@@ -155,13 +147,10 @@ int fsl_bpop2(RedisModuleCtx *ctx, RedisModuleString **argv, int argc) {
if (!get_fsl(ctx, argv[1], REDISMODULE_READ, 0, &fsl, 1))
return REDISMODULE_OK;
if (!fsl || fsl->length < 2) {
/* Key is empty or has <2 elements, we must block */
RedisModule_BlockClientOnKeys(ctx, bpop2_reply_callback, bpop2_timeout_callback,
if (!fsl) {
RedisModule_BlockClientOnKeys(ctx, bpop_reply_callback, bpop_timeout_callback,
NULL, timeout, &argv[1], 1, NULL);
} else {
RedisModule_ReplyWithArray(ctx, 2);
RedisModule_ReplyWithLongLong(ctx, fsl->list[--fsl->length]);
RedisModule_ReplyWithLongLong(ctx, fsl->list[--fsl->length]);
}
@@ -172,13 +161,13 @@ int bpopgt_reply_callback(RedisModuleCtx *ctx, RedisModuleString **argv, int arg
REDISMODULE_NOT_USED(argv);
REDISMODULE_NOT_USED(argc);
RedisModuleString *keyname = RedisModule_GetBlockedClientReadyKey(ctx);
long long gt = (long long)RedisModule_GetBlockedClientPrivateData(ctx);
long long *pgt = RedisModule_GetBlockedClientPrivateData(ctx);
fsl_t *fsl;
if (!get_fsl(ctx, keyname, REDISMODULE_READ, 0, &fsl, 0))
if (!get_fsl(ctx, keyname, REDISMODULE_READ, 0, &fsl, 0) || !fsl)
return REDISMODULE_ERR;
if (!fsl || fsl->list[fsl->length-1] <= gt)
if (fsl->list[fsl->length-1] <= *pgt)
return REDISMODULE_ERR;
RedisModule_ReplyWithLongLong(ctx, fsl->list[--fsl->length]);
@@ -192,10 +181,8 @@ int bpopgt_timeout_callback(RedisModuleCtx *ctx, RedisModuleString **argv, int a
}
void bpopgt_free_privdata(RedisModuleCtx *ctx, void *privdata) {
/* Nothing to do because privdata is actually a 'long long',
* not a pointer to the heap */
REDISMODULE_NOT_USED(ctx);
REDISMODULE_NOT_USED(privdata);
RedisModule_Free(privdata);
}
/* FSL.BPOPGT <key> <gt> <timeout> - Block clients until list has an element greater than <gt>.
@@ -217,9 +204,11 @@ int fsl_bpopgt(RedisModuleCtx *ctx, RedisModuleString **argv, int argc) {
return REDISMODULE_OK;
if (!fsl || fsl->list[fsl->length-1] <= gt) {
/* Key is empty or has <2 elements, we must block */
/* We use malloc so the tests in blockedonkeys.tcl can check for memory leaks */
long long *pgt = RedisModule_Alloc(sizeof(long long));
*pgt = gt;
RedisModule_BlockClientOnKeys(ctx, bpopgt_reply_callback, bpopgt_timeout_callback,
bpopgt_free_privdata, timeout, &argv[1], 1, (void*)gt);
bpopgt_free_privdata, timeout, &argv[1], 1, pgt);
} else {
RedisModule_ReplyWithLongLong(ctx, fsl->list[--fsl->length]);
}
@@ -227,6 +216,88 @@ int fsl_bpopgt(RedisModuleCtx *ctx, RedisModuleString **argv, int argc) {
return REDISMODULE_OK;
}
int bpoppush_reply_callback(RedisModuleCtx *ctx, RedisModuleString **argv, int argc) {
REDISMODULE_NOT_USED(argv);
REDISMODULE_NOT_USED(argc);
RedisModuleString *src_keyname = RedisModule_GetBlockedClientReadyKey(ctx);
RedisModuleString *dst_keyname = RedisModule_GetBlockedClientPrivateData(ctx);
fsl_t *src;
if (!get_fsl(ctx, src_keyname, REDISMODULE_READ, 0, &src, 0) || !src)
return REDISMODULE_ERR;
fsl_t *dst;
if (!get_fsl(ctx, dst_keyname, REDISMODULE_WRITE, 1, &dst, 0) || !dst)
return REDISMODULE_ERR;
long long ele = src->list[--src->length];
dst->list[dst->length++] = ele;
RedisModule_SignalKeyAsReady(ctx, dst_keyname);
return RedisModule_ReplyWithLongLong(ctx, ele);
}
int bpoppush_timeout_callback(RedisModuleCtx *ctx, RedisModuleString **argv, int argc) {
REDISMODULE_NOT_USED(argv);
REDISMODULE_NOT_USED(argc);
return RedisModule_ReplyWithSimpleString(ctx, "Request timedout");
}
void bpoppush_free_privdata(RedisModuleCtx *ctx, void *privdata) {
RedisModule_FreeString(ctx, privdata);
}
/* FSL.BPOPPUSH <src> <dst> <timeout> - Block clients until <src> has an element.
* When that happens, unblock client, pop the last element from <src> and push it to <dst>
* (from the right). */
int fsl_bpoppush(RedisModuleCtx *ctx, RedisModuleString **argv, int argc) {
if (argc != 4)
return RedisModule_WrongArity(ctx);
long long timeout;
if (RedisModule_StringToLongLong(argv[3],&timeout) != REDISMODULE_OK || timeout < 0)
return RedisModule_ReplyWithError(ctx,"ERR invalid timeout");
fsl_t *src;
if (!get_fsl(ctx, argv[1], REDISMODULE_READ, 0, &src, 1))
return REDISMODULE_OK;
if (!src) {
/* Retain string for reply callback */
RedisModule_RetainString(ctx, argv[2]);
/* Key is empty, we must block */
RedisModule_BlockClientOnKeys(ctx, bpoppush_reply_callback, bpoppush_timeout_callback,
bpoppush_free_privdata, timeout, &argv[1], 1, argv[2]);
} else {
fsl_t *dst;
if (!get_fsl(ctx, argv[2], REDISMODULE_WRITE, 1, &dst, 1))
return REDISMODULE_OK;
long long ele = src->list[--src->length];
dst->list[dst->length++] = ele;
RedisModule_SignalKeyAsReady(ctx, argv[2]);
RedisModule_ReplyWithLongLong(ctx, ele);
}
return REDISMODULE_OK;
}
/* FSL.GETALL <key> - Reply with an array containing all elements. */
int fsl_getall(RedisModuleCtx *ctx, RedisModuleString **argv, int argc) {
if (argc != 2)
return RedisModule_WrongArity(ctx);
fsl_t *fsl;
if (!get_fsl(ctx, argv[1], REDISMODULE_READ, 0, &fsl, 1))
return REDISMODULE_OK;
if (!fsl)
return RedisModule_ReplyWithArray(ctx, 0);
RedisModule_ReplyWithArray(ctx, fsl->length);
for (int i = 0; i < fsl->length; i++)
RedisModule_ReplyWithLongLong(ctx, fsl->list[i]);
return REDISMODULE_OK;
}
int RedisModule_OnLoad(RedisModuleCtx *ctx, RedisModuleString **argv, int argc) {
REDISMODULE_NOT_USED(argv);
REDISMODULE_NOT_USED(argc);
@@ -251,11 +322,17 @@ int RedisModule_OnLoad(RedisModuleCtx *ctx, RedisModuleString **argv, int argc)
if (RedisModule_CreateCommand(ctx,"fsl.push",fsl_push,"",0,0,0) == REDISMODULE_ERR)
return REDISMODULE_ERR;
if (RedisModule_CreateCommand(ctx,"fsl.bpop2",fsl_bpop2,"",0,0,0) == REDISMODULE_ERR)
if (RedisModule_CreateCommand(ctx,"fsl.bpop",fsl_bpop,"",0,0,0) == REDISMODULE_ERR)
return REDISMODULE_ERR;
if (RedisModule_CreateCommand(ctx,"fsl.bpopgt",fsl_bpopgt,"",0,0,0) == REDISMODULE_ERR)
return REDISMODULE_ERR;
if (RedisModule_CreateCommand(ctx,"fsl.bpoppush",fsl_bpoppush,"",0,0,0) == REDISMODULE_ERR)
return REDISMODULE_ERR;
if (RedisModule_CreateCommand(ctx,"fsl.getall",fsl_getall,"",0,0,0) == REDISMODULE_ERR)
return REDISMODULE_ERR;
return REDISMODULE_OK;
}
+1 -1
View File
@@ -42,7 +42,7 @@ int fork_create(RedisModuleCtx *ctx, RedisModuleString **argv, int argc)
/* child */
RedisModule_Log(ctx, "notice", "fork child started");
usleep(200000);
usleep(500000);
RedisModule_Log(ctx, "notice", "fork child exiting");
RedisModule_ExitFromChild(code_to_exit_with);
/* unreachable */
+13
View File
@@ -74,6 +74,19 @@ int test_ld_conv(RedisModuleCtx *ctx, RedisModuleString **argv, int argc) {
RedisModule_ReplyWithError(ctx, err);
goto final;
}
/* Make sure we can't convert a string that has \0 in it */
char buf[4] = "123";
buf[1] = '\0';
RedisModuleString *s3 = RedisModule_CreateString(ctx, buf, 3);
long double ld3;
if (RedisModule_StringToLongDouble(s3, &ld3) == REDISMODULE_OK) {
RedisModule_ReplyWithError(ctx, "Invalid string successfully converted to long double");
RedisModule_FreeString(ctx, s3);
goto final;
}
RedisModule_FreeString(ctx, s3);
RedisModule_ReplyWithLongDouble(ctx, ld2);
final:
RedisModule_FreeString(ctx, s1);
+45 -1
View File
@@ -64,7 +64,8 @@ void *threadMain(void *arg) {
RedisModule_SelectDb(ctx,9); /* Tests ran in database number 9. */
for (int i = 0; i < 10; i++) {
RedisModule_ThreadSafeContextLock(ctx);
RedisModule_Replicate(ctx,"INCR","c","thread");
RedisModule_Replicate(ctx,"INCR","c","a-from-thread");
RedisModule_Replicate(ctx,"INCR","c","b-from-thread");
RedisModule_ThreadSafeContextUnlock(ctx);
}
RedisModule_FreeThreadSafeContext(ctx);
@@ -89,6 +90,38 @@ int propagateTestCommand(RedisModuleCtx *ctx, RedisModuleString **argv, int argc
return REDISMODULE_OK;
}
int propagateTest2Command(RedisModuleCtx *ctx, RedisModuleString **argv, int argc)
{
REDISMODULE_NOT_USED(argv);
REDISMODULE_NOT_USED(argc);
/* Replicate two commands to test MULTI/EXEC wrapping. */
RedisModule_Replicate(ctx,"INCR","c","counter-1");
RedisModule_Replicate(ctx,"INCR","c","counter-2");
RedisModule_ReplyWithSimpleString(ctx,"OK");
return REDISMODULE_OK;
}
int propagateTest3Command(RedisModuleCtx *ctx, RedisModuleString **argv, int argc)
{
REDISMODULE_NOT_USED(argv);
REDISMODULE_NOT_USED(argc);
RedisModuleCallReply *reply;
/* This test mixes multiple propagation systems. */
reply = RedisModule_Call(ctx, "INCR", "c!", "using-call");
RedisModule_FreeCallReply(reply);
RedisModule_Replicate(ctx,"INCR","c","counter-1");
RedisModule_Replicate(ctx,"INCR","c","counter-2");
reply = RedisModule_Call(ctx, "INCR", "c!", "after-call");
RedisModule_FreeCallReply(reply);
RedisModule_ReplyWithSimpleString(ctx,"OK");
return REDISMODULE_OK;
}
int RedisModule_OnLoad(RedisModuleCtx *ctx, RedisModuleString **argv, int argc) {
REDISMODULE_NOT_USED(argv);
REDISMODULE_NOT_USED(argc);
@@ -100,5 +133,16 @@ int RedisModule_OnLoad(RedisModuleCtx *ctx, RedisModuleString **argv, int argc)
propagateTestCommand,
"",1,1,1) == REDISMODULE_ERR)
return REDISMODULE_ERR;
if (RedisModule_CreateCommand(ctx,"propagate-test-2",
propagateTest2Command,
"",1,1,1) == REDISMODULE_ERR)
return REDISMODULE_ERR;
if (RedisModule_CreateCommand(ctx,"propagate-test-3",
propagateTest3Command,
"",1,1,1) == REDISMODULE_ERR)
return REDISMODULE_ERR;
return REDISMODULE_OK;
}
+87 -39
View File
@@ -53,6 +53,7 @@ proc kill_server config {
}
# kill server and wait for the process to be totally exited
send_data_packet $::test_server_fd server-killing $pid
catch {exec kill $pid}
if {$::valgrind} {
set max_wait 60000
@@ -140,6 +141,18 @@ proc tags {tags code} {
uplevel 1 $code
set ::tags [lrange $::tags 0 end-[llength $tags]]
}
# Write the configuration in the dictionary 'config' in the specified
# file name.
proc create_server_config_file {filename config} {
set fp [open $filename w+]
foreach directive [dict keys $config] {
puts -nonewline $fp "$directive "
puts $fp [dict get $config $directive]
}
close $fp
}
proc start_server {options {code undefined}} {
# If we are running against an external server, we just push the
# host/port pair in the stack the first time
@@ -221,56 +234,91 @@ proc start_server {options {code undefined}} {
# write new configuration to temporary file
set config_file [tmpfile redis.conf]
set fp [open $config_file w+]
foreach directive [dict keys $config] {
puts -nonewline $fp "$directive "
puts $fp [dict get $config $directive]
}
close $fp
create_server_config_file $config_file $config
set stdout [format "%s/%s" [dict get $config "dir"] "stdout"]
set stderr [format "%s/%s" [dict get $config "dir"] "stderr"]
if {$::valgrind} {
set pid [exec valgrind --track-origins=yes --suppressions=src/valgrind.sup --show-reachable=no --show-possibly-lost=no --leak-check=full src/redis-server $config_file > $stdout 2> $stderr &]
} elseif ($::stack_logging) {
set pid [exec /usr/bin/env MallocStackLogging=1 MallocLogFile=/tmp/malloc_log.txt src/redis-server $config_file > $stdout 2> $stderr &]
} else {
set pid [exec src/redis-server $config_file > $stdout 2> $stderr &]
}
# We need a loop here to retry with different ports.
set server_started 0
while {$server_started == 0} {
if {$::verbose} {
puts -nonewline "=== ($tags) Starting server ${::host}:${::port} "
}
# Tell the test server about this new instance.
send_data_packet $::test_server_fd server-spawned $pid
send_data_packet $::test_server_fd "server-spawning" "port $::port"
# check that the server actually started
# ugly but tries to be as fast as possible...
if {$::valgrind} {set retrynum 1000} else {set retrynum 100}
if {$::valgrind} {
set pid [exec valgrind --track-origins=yes --suppressions=src/valgrind.sup --show-reachable=no --show-possibly-lost=no --leak-check=full src/redis-server $config_file > $stdout 2> $stderr &]
} elseif ($::stack_logging) {
set pid [exec /usr/bin/env MallocStackLogging=1 MallocLogFile=/tmp/malloc_log.txt src/redis-server $config_file > $stdout 2> $stderr &]
} else {
set pid [exec src/redis-server $config_file > $stdout 2> $stderr &]
}
if {$::verbose} {
puts -nonewline "=== ($tags) Starting server ${::host}:${::port} "
}
# Tell the test server about this new instance.
send_data_packet $::test_server_fd server-spawned $pid
if {$code ne "undefined"} {
set serverisup [server_is_up $::host $::port $retrynum]
} else {
set serverisup 1
}
# check that the server actually started
# ugly but tries to be as fast as possible...
if {$::valgrind} {set retrynum 1000} else {set retrynum 100}
if {$::verbose} {
puts ""
}
# Wait for actual startup
set checkperiod 100; # Milliseconds
set maxiter [expr {120*1000/100}] ; # Wait up to 2 minutes.
set port_busy 0
while {![info exists _pid]} {
regexp {PID:\s(\d+)} [exec cat $stdout] _ _pid
after $checkperiod
incr maxiter -1
if {$maxiter == 0} {
start_server_error $config_file "No PID detected in log $stdout"
puts "--- LOG CONTENT ---"
puts [exec cat $stdout]
puts "-------------------"
break
}
if {!$serverisup} {
set err {}
append err [exec cat $stdout] "\n" [exec cat $stderr]
start_server_error $config_file $err
return
}
# Check if the port is actually busy and the server failed
# for this reason.
if {[regexp {Could not create server TCP} [exec cat $stdout]]} {
set port_busy 1
break
}
}
# Wait for actual startup
while {![info exists _pid]} {
regexp {PID:\s(\d+)} [exec cat $stdout] _ _pid
after 100
# Sometimes we have to try a different port, even if we checked
# for availability. Other test clients may grab the port before we
# are able to do it for example.
if {$port_busy} {
puts "Port $::port was already busy, trying another port..."
set ::port [find_available_port [expr {$::port+1}]]
if {$::tls} {
dict set config "tls-port" $::port
} else {
dict set config port $::port
}
create_server_config_file $config_file $config
continue; # Try again
}
if {$code ne "undefined"} {
set serverisup [server_is_up $::host $::port $retrynum]
} else {
set serverisup 1
}
if {$::verbose} {
puts ""
}
if {!$serverisup} {
set err {}
append err [exec cat $stdout] "\n" [exec cat $stderr]
start_server_error $config_file $err
return
}
set server_started 1
}
# setup properties to be able to initialize a client object
+22 -10
View File
@@ -47,6 +47,7 @@ set ::all_tests {
integration/logging
integration/psync2
integration/psync2-reg
integration/psync2-pingoff
unit/pubsub
unit/slowlog
unit/scripting
@@ -87,7 +88,7 @@ set ::file ""; # If set, runs only the tests in this comma separated list
set ::curfile ""; # Hold the filename of the current suite
set ::accurate 0; # If true runs fuzz tests with more iterations
set ::force_failure 0
set ::timeout 600; # 10 minutes without progresses will quit the test.
set ::timeout 1200; # 20 minutes without progresses will quit the test.
set ::last_progress [clock seconds]
set ::active_servers {} ; # Pids of active Redis instances.
set ::dont_clean 0
@@ -211,13 +212,19 @@ proc test_server_main {} {
# Start the client instances
set ::clients_pids {}
set start_port [expr {$::port+100}]
for {set j 0} {$j < $::numclients} {incr j} {
set start_port [find_available_port $start_port]
if {$::external} {
set p [exec $tclsh [info script] {*}$::argv \
--client $port --port $start_port &]
--client $port --port $::port &]
lappend ::clients_pids $p
incr start_port 10
} else {
set start_port [expr {$::port+100}]
for {set j 0} {$j < $::numclients} {incr j} {
set start_port [find_available_port $start_port]
set p [exec $tclsh [info script] {*}$::argv \
--client $port --port $start_port &]
lappend ::clients_pids $p
incr start_port 10
}
}
# Setup global state for the test server
@@ -289,7 +296,7 @@ proc read_from_test_client fd {
puts "\[$completed_tests_count/$all_tests_count [colorstr yellow $status]\]: $data ($elapsed seconds)"
lappend ::clients_time_history $elapsed $data
signal_idle_client $fd
set ::active_clients_task($fd) DONE
set ::active_clients_task($fd) "(DONE) $data"
} elseif {$status eq {ok}} {
if {!$::quiet} {
puts "\[[colorstr green $status]\]: $data"
@@ -320,10 +327,16 @@ proc read_from_test_client fd {
exit 1
} elseif {$status eq {testing}} {
set ::active_clients_task($fd) "(IN PROGRESS) $data"
} elseif {$status eq {server-spawning}} {
set ::active_clients_task($fd) "(SPAWNING SERVER) $data"
} elseif {$status eq {server-spawned}} {
lappend ::active_servers $data
set ::active_clients_task($fd) "(SPAWNED SERVER) pid:$data"
} elseif {$status eq {server-killing}} {
set ::active_clients_task($fd) "(KILLING SERVER) pid:$data"
} elseif {$status eq {server-killed}} {
set ::active_servers [lsearch -all -inline -not -exact $::active_servers $data]
set ::active_clients_task($fd) "(KILLED SERVER) pid:$data"
} else {
if {!$::quiet} {
puts "\[$status\]: $data"
@@ -333,7 +346,7 @@ proc read_from_test_client fd {
proc show_clients_state {} {
# The following loop is only useful for debugging tests that may
# enter an infinite loop. Commented out normally.
# enter an infinite loop.
foreach x $::active_clients {
if {[info exist ::active_clients_task($x)]} {
puts "$x => $::active_clients_task($x)"
@@ -363,8 +376,6 @@ proc signal_idle_client fd {
set ::active_clients \
[lsearch -all -inline -not -exact $::active_clients $fd]
if 0 {show_clients_state}
# New unit to process?
if {$::next_test != [llength $::all_tests]} {
if {!$::quiet} {
@@ -380,6 +391,7 @@ proc signal_idle_client fd {
}
} else {
lappend ::idle_clients $fd
set ::active_clients_task($fd) "SLEEPING, no more units to assign"
if {[llength $::active_clients] == 0} {
the_end
}
+114
View File
@@ -141,4 +141,118 @@ start_server {tags {"acl"}} {
r ACL setuser newuser -debug
# The test framework will detect a leak if any.
}
test {ACL LOG shows failed command executions at toplevel} {
r ACL LOG RESET
r ACL setuser antirez >foo on +set ~object:1234
r ACL setuser antirez +eval +multi +exec
r AUTH antirez foo
catch {r GET foo}
r AUTH default ""
set entry [lindex [r ACL LOG] 0]
assert {[dict get $entry username] eq {antirez}}
assert {[dict get $entry context] eq {toplevel}}
assert {[dict get $entry reason] eq {command}}
assert {[dict get $entry object] eq {get}}
}
test {ACL LOG is able to test similar events} {
r AUTH antirez foo
catch {r GET foo}
catch {r GET foo}
catch {r GET foo}
r AUTH default ""
set entry [lindex [r ACL LOG] 0]
assert {[dict get $entry count] == 4}
}
test {ACL LOG is able to log keys access violations and key name} {
r AUTH antirez foo
catch {r SET somekeynotallowed 1234}
r AUTH default ""
set entry [lindex [r ACL LOG] 0]
assert {[dict get $entry reason] eq {key}}
assert {[dict get $entry object] eq {somekeynotallowed}}
}
test {ACL LOG RESET is able to flush the entries in the log} {
r ACL LOG RESET
assert {[llength [r ACL LOG]] == 0}
}
test {ACL LOG can distinguish the transaction context (1)} {
r AUTH antirez foo
r MULTI
catch {r INCR foo}
catch {r EXEC}
r AUTH default ""
set entry [lindex [r ACL LOG] 0]
assert {[dict get $entry context] eq {multi}}
assert {[dict get $entry object] eq {incr}}
}
test {ACL LOG can distinguish the transaction context (2)} {
set rd1 [redis_deferring_client]
r ACL SETUSER antirez +incr
r AUTH antirez foo
r MULTI
r INCR object:1234
$rd1 ACL SETUSER antirez -incr
$rd1 read
catch {r EXEC}
$rd1 close
r AUTH default ""
set entry [lindex [r ACL LOG] 0]
assert {[dict get $entry context] eq {multi}}
assert {[dict get $entry object] eq {incr}}
r ACL SETUSER antirez -incr
}
test {ACL can log errors in the context of Lua scripting} {
r AUTH antirez foo
catch {r EVAL {redis.call('incr','foo')} 0}
r AUTH default ""
set entry [lindex [r ACL LOG] 0]
assert {[dict get $entry context] eq {lua}}
assert {[dict get $entry object] eq {incr}}
}
test {ACL LOG can accept a numerical argument to show less entries} {
r AUTH antirez foo
catch {r INCR foo}
catch {r INCR foo}
catch {r INCR foo}
catch {r INCR foo}
r AUTH default ""
assert {[llength [r ACL LOG]] > 1}
assert {[llength [r ACL LOG 2]] == 2}
}
test {ACL LOG can log failed auth attempts} {
catch {r AUTH antirez wrong-password}
set entry [lindex [r ACL LOG] 0]
assert {[dict get $entry context] eq {toplevel}}
assert {[dict get $entry reason] eq {auth}}
assert {[dict get $entry object] eq {AUTH}}
assert {[dict get $entry username] eq {antirez}}
}
test {ACL LOG entries are limited to a maximum amount} {
r ACL LOG RESET
r CONFIG SET acllog-max-len 5
r AUTH antirez foo
for {set j 0} {$j < 10} {incr j} {
catch {r SET obj:$j 123}
}
r AUTH default ""
assert {[llength [r ACL LOG]] == 5}
}
test {When default user is off, new connections are not authenticated} {
r ACL setuser default off
catch {set rd1 [redis_deferring_client]} e
r ACL setuser default on
set e
} {*NOAUTH*}
}
+31
View File
@@ -199,3 +199,34 @@ start_server {tags {"bitops"}} {
r del mystring
}
}
start_server {tags {"repl"}} {
start_server {} {
set master [srv -1 client]
set master_host [srv -1 host]
set master_port [srv -1 port]
set slave [srv 0 client]
test {BITFIELD: setup slave} {
$slave slaveof $master_host $master_port
wait_for_condition 50 100 {
[s 0 master_link_status] eq {up}
} else {
fail "Replication not started."
}
}
test {BITFIELD: write on master, read on slave} {
$master del bits
assert_equal 0 [$master bitfield bits set u8 0 255]
assert_equal 255 [$master bitfield bits set u8 0 100]
wait_for_ofs_sync $master $slave
assert_equal 100 [$slave bitfield_ro bits get u8 0]
}
test {BITFIELD_RO fails when write option is used} {
catch {$slave bitfield_ro bits set u8 0 100 get u8 0} err
assert_match {*ERR BITFIELD_RO only supports the GET subcommand*} $err
}
}
}
+1 -1
View File
@@ -65,7 +65,7 @@ start_server {tags {"introspection"}} {
rdbchecksum
daemonize
io-threads-do-reads
lua-replicate-commands
tcp-backlog
always-show-logo
syslog-enabled
cluster-enabled
+125 -8
View File
@@ -39,6 +39,8 @@ start_server {tags {"memefficiency"}} {
start_server {tags {"defrag"}} {
if {[string match {*jemalloc*} [s mem_allocator]]} {
test "Active defrag" {
r config set save "" ;# prevent bgsave from interfereing with save below
r config set hz 100
r config set activedefrag no
r config set active-defrag-threshold-lower 5
r config set active-defrag-cycle-min 65
@@ -46,8 +48,8 @@ start_server {tags {"defrag"}} {
r config set active-defrag-ignore-bytes 2mb
r config set maxmemory 100mb
r config set maxmemory-policy allkeys-lru
r debug populate 700000 asdf 150
r debug populate 170000 asdf 300
r debug populate 700000 asdf1 150
r debug populate 170000 asdf2 300
r ping ;# trigger eviction following the previous population
after 120 ;# serverCron only updates the info once in 100ms
set frag [s allocator_frag_ratio]
@@ -55,6 +57,11 @@ start_server {tags {"defrag"}} {
puts "frag $frag"
}
assert {$frag >= 1.4}
r config set latency-monitor-threshold 5
r latency reset
r config set maxmemory 110mb ;# prevent further eviction (not to fail the digest test)
set digest [r debug digest]
catch {r config set activedefrag yes} e
if {![string match {DISABLED*} $e]} {
# Wait for the active defrag to start working (decision once a
@@ -78,19 +85,37 @@ start_server {tags {"defrag"}} {
# Test the the fragmentation is lower.
after 120 ;# serverCron only updates the info once in 100ms
set frag [s allocator_frag_ratio]
set max_latency 0
foreach event [r latency latest] {
lassign $event eventname time latency max
if {$eventname == "active-defrag-cycle"} {
set max_latency $max
}
}
if {$::verbose} {
puts "frag $frag"
puts "max latency $max_latency"
puts [r latency latest]
puts [r latency history active-defrag-cycle]
}
assert {$frag < 1.1}
# due to high fragmentation, 100hz, and active-defrag-cycle-max set to 75,
# we expect max latency to be not much higher than 7.5ms but due to rare slowness threshold is set higher
assert {$max_latency <= 30}
} else {
set _ ""
}
} {}
# verify the data isn't corrupted or changed
set newdigest [r debug digest]
assert {$digest eq $newdigest}
r save ;# saving an rdb iterates over all the data / pointers
} {OK}
test "Active defrag big keys" {
r flushdb
r config resetstat
r config set save "" ;# prevent bgsave from interfereing with save below
r config set hz 100
r config set activedefrag no
r config set active-defrag-max-scan-fields 1000
r config set active-defrag-threshold-lower 5
@@ -142,7 +167,7 @@ start_server {tags {"defrag"}} {
for {set j 0} {$j < 500000} {incr j} {
$rd read ; # Discard replies
}
assert {[r dbsize] == 500010}
assert_equal [r dbsize] 500010
# create some fragmentation
for {set j 0} {$j < 500000} {incr j 2} {
@@ -151,7 +176,7 @@ start_server {tags {"defrag"}} {
for {set j 0} {$j < 500000} {incr j 2} {
$rd read ; # Discard replies
}
assert {[r dbsize] == 250010}
assert_equal [r dbsize] 250010
# start defrag
after 120 ;# serverCron only updates the info once in 100ms
@@ -200,14 +225,106 @@ start_server {tags {"defrag"}} {
puts [r latency history active-defrag-cycle]
}
assert {$frag < 1.1}
# due to high fragmentation, 10hz, and active-defrag-cycle-max set to 75,
# we expect max latency to be not much higher than 75ms
assert {$max_latency <= 120}
# due to high fragmentation, 100hz, and active-defrag-cycle-max set to 75,
# we expect max latency to be not much higher than 7.5ms but due to rare slowness threshold is set higher
assert {$max_latency <= 30}
}
# verify the data isn't corrupted or changed
set newdigest [r debug digest]
assert {$digest eq $newdigest}
r save ;# saving an rdb iterates over all the data / pointers
} {OK}
test "Active defrag big list" {
r flushdb
r config resetstat
r config set save "" ;# prevent bgsave from interfereing with save below
r config set hz 100
r config set activedefrag no
r config set active-defrag-max-scan-fields 1000
r config set active-defrag-threshold-lower 5
r config set active-defrag-cycle-min 65
r config set active-defrag-cycle-max 75
r config set active-defrag-ignore-bytes 2mb
r config set maxmemory 0
r config set list-max-ziplist-size 5 ;# list of 500k items will have 100k quicklist nodes
# create big keys with 10k items
set rd [redis_deferring_client]
set expected_frag 1.7
# add a mass of list nodes to two lists (allocations are interlaced)
set val [string repeat A 100] ;# 5 items of 100 bytes puts us in the 640 bytes bin, which has 32 regs, so high potential for fragmentation
for {set j 0} {$j < 500000} {incr j} {
$rd lpush biglist1 $val
$rd lpush biglist2 $val
}
for {set j 0} {$j < 500000} {incr j} {
$rd read ; # Discard replies
$rd read ; # Discard replies
}
# create some fragmentation
r del biglist2
# start defrag
after 120 ;# serverCron only updates the info once in 100ms
set frag [s allocator_frag_ratio]
if {$::verbose} {
puts "frag $frag"
}
assert {$frag >= $expected_frag}
r config set latency-monitor-threshold 5
r latency reset
set digest [r debug digest]
catch {r config set activedefrag yes} e
if {![string match {DISABLED*} $e]} {
# wait for the active defrag to start working (decision once a second)
wait_for_condition 50 100 {
[s active_defrag_running] ne 0
} else {
fail "defrag not started."
}
# wait for the active defrag to stop working
wait_for_condition 500 100 {
[s active_defrag_running] eq 0
} else {
after 120 ;# serverCron only updates the info once in 100ms
puts [r info memory]
puts [r info stats]
puts [r memory malloc-stats]
fail "defrag didn't stop."
}
# test the the fragmentation is lower
after 120 ;# serverCron only updates the info once in 100ms
set frag [s allocator_frag_ratio]
set max_latency 0
foreach event [r latency latest] {
lassign $event eventname time latency max
if {$eventname == "active-defrag-cycle"} {
set max_latency $max
}
}
if {$::verbose} {
puts "frag $frag"
puts "max latency $max_latency"
puts [r latency latest]
puts [r latency history active-defrag-cycle]
}
assert {$frag < 1.1}
# due to high fragmentation, 100hz, and active-defrag-cycle-max set to 75,
# we expect max latency to be not much higher than 7.5ms but due to rare slowness threshold is set higher
assert {$max_latency <= 30}
}
# verify the data isn't corrupted or changed
set newdigest [r debug digest]
assert {$digest eq $newdigest}
r save ;# saving an rdb iterates over all the data / pointers
r del biglist1 ;# coverage for quicklistBookmarksClear
} {1}
}
}
+123 -20
View File
@@ -3,37 +3,70 @@ set testmodule [file normalize tests/modules/blockonkeys.so]
start_server {tags {"modules"}} {
r module load $testmodule
test "Module client blocked on keys: Circular BPOPPUSH" {
set rd1 [redis_deferring_client]
set rd2 [redis_deferring_client]
r del src dst
$rd1 fsl.bpoppush src dst 0
$rd2 fsl.bpoppush dst src 0
;# wait until clients are actually blocked
wait_for_condition 50 100 {
[s 0 blocked_clients] eq {2}
} else {
fail "Clients are not blocked"
}
r fsl.push src 42
assert_equal {42} [r fsl.getall src]
assert_equal {} [r fsl.getall dst]
}
test "Module client blocked on keys: Self-referential BPOPPUSH" {
set rd1 [redis_deferring_client]
r del src
$rd1 fsl.bpoppush src src 0
;# wait until clients are actually blocked
wait_for_condition 50 100 {
[s 0 blocked_clients] eq {1}
} else {
fail "Clients are not blocked"
}
r fsl.push src 42
assert_equal {42} [r fsl.getall src]
}
test {Module client blocked on keys (no metadata): No block} {
r del k
r fsl.push k 33
r fsl.push k 34
r fsl.bpop2 k 0
} {34 33}
r fsl.bpop k 0
} {34}
test {Module client blocked on keys (no metadata): Timeout} {
r del k
set rd [redis_deferring_client]
r fsl.push k 33
$rd fsl.bpop2 k 1
$rd fsl.bpop k 1
assert_equal {Request timedout} [$rd read]
}
test {Module client blocked on keys (no metadata): Blocked, case 1} {
test {Module client blocked on keys (no metadata): Blocked} {
r del k
set rd [redis_deferring_client]
r fsl.push k 33
$rd fsl.bpop2 k 0
$rd fsl.bpop k 0
;# wait until clients are actually blocked
wait_for_condition 50 100 {
[s 0 blocked_clients] eq {1}
} else {
fail "Clients are not blocked"
}
r fsl.push k 34
assert_equal {34 33} [$rd read]
}
test {Module client blocked on keys (no metadata): Blocked, case 2} {
r del k
set rd [redis_deferring_client]
r fsl.push k 33
r fsl.push k 34
$rd fsl.bpop2 k 0
assert_equal {34 33} [$rd read]
assert_equal {34} [$rd read]
}
test {Module client blocked on keys (with metadata): No block} {
@@ -45,24 +78,42 @@ start_server {tags {"modules"}} {
test {Module client blocked on keys (with metadata): Timeout} {
r del k
set rd [redis_deferring_client]
$rd client id
set cid [$rd read]
r fsl.push k 33
$rd fsl.bpopgt k 35 1
assert_equal {Request timedout} [$rd read]
r client kill id $cid ;# try to smoke-out client-related memory leak
}
test {Module client blocked on keys (with metadata): Blocked, case 1} {
r del k
set rd [redis_deferring_client]
$rd client id
set cid [$rd read]
r fsl.push k 33
$rd fsl.bpopgt k 33 0
;# wait until clients are actually blocked
wait_for_condition 50 100 {
[s 0 blocked_clients] eq {1}
} else {
fail "Clients are not blocked"
}
r fsl.push k 34
assert_equal {34} [$rd read]
r client kill id $cid ;# try to smoke-out client-related memory leak
}
test {Module client blocked on keys (with metadata): Blocked, case 2} {
r del k
set rd [redis_deferring_client]
$rd fsl.bpopgt k 35 0
;# wait until clients are actually blocked
wait_for_condition 50 100 {
[s 0 blocked_clients] eq {1}
} else {
fail "Clients are not blocked"
}
r fsl.push k 33
r fsl.push k 34
r fsl.push k 35
@@ -70,16 +121,68 @@ start_server {tags {"modules"}} {
assert_equal {36} [$rd read]
}
test {Module client blocked on keys (with metadata): Blocked, CLIENT KILL} {
r del k
set rd [redis_deferring_client]
$rd client id
set cid [$rd read]
$rd fsl.bpopgt k 35 0
;# wait until clients are actually blocked
wait_for_condition 50 100 {
[s 0 blocked_clients] eq {1}
} else {
fail "Clients are not blocked"
}
r client kill id $cid ;# try to smoke-out client-related memory leak
}
test {Module client blocked on keys (with metadata): Blocked, CLIENT UNBLOCK TIMEOUT} {
r del k
set rd [redis_deferring_client]
$rd client id
set cid [$rd read]
$rd fsl.bpopgt k 35 0
;# wait until clients are actually blocked
wait_for_condition 50 100 {
[s 0 blocked_clients] eq {1}
} else {
fail "Clients are not blocked"
}
r client unblock $cid timeout ;# try to smoke-out client-related memory leak
assert_equal {Request timedout} [$rd read]
}
test {Module client blocked on keys (with metadata): Blocked, CLIENT UNBLOCK ERROR} {
r del k
set rd [redis_deferring_client]
$rd client id
set cid [$rd read]
$rd fsl.bpopgt k 35 0
;# wait until clients are actually blocked
wait_for_condition 50 100 {
[s 0 blocked_clients] eq {1}
} else {
fail "Clients are not blocked"
}
r client unblock $cid error ;# try to smoke-out client-related memory leak
assert_error "*unblocked*" {$rd read}
}
test {Module client blocked on keys does not wake up on wrong type} {
r del k
set rd [redis_deferring_client]
$rd fsl.bpop2 k 0
$rd fsl.bpop k 0
;# wait until clients are actually blocked
wait_for_condition 50 100 {
[s 0 blocked_clients] eq {1}
} else {
fail "Clients are not blocked"
}
r lpush k 12
r lpush k 13
r lpush k 14
r del k
r fsl.push k 33
r fsl.push k 34
assert_equal {34 33} [$rd read]
assert_equal {34} [$rd read]
}
}
+1 -2
View File
@@ -20,9 +20,8 @@ start_server {tags {"modules"}} {
test {Module fork kill} {
r fork.create 3
after 20
after 250
r fork.kill
after 100
assert {[count_log_message "fork child started"] eq "2"}
assert {[count_log_message "Received SIGUSR1 in child"] eq "1"}
+34 -1
View File
@@ -20,11 +20,44 @@ tags "modules" {
wait_for_condition 5000 10 {
([$replica get timer] eq "10") && \
([$replica get thread] eq "10")
([$replica get a-from-thread] eq "10")
} else {
fail "The two counters don't match the expected value."
}
$master propagate-test-2
$master propagate-test-3
$master multi
$master propagate-test-2
$master propagate-test-3
$master exec
wait_for_ofs_sync $master $replica
assert_equal [s -1 unexpected_error_replies] 0
}
}
}
}
tags "modules aof" {
test {Modules RM_Replicate replicates MULTI/EXEC correctly} {
start_server [list overrides [list loadmodule "$testmodule"]] {
# Enable the AOF
r config set appendonly yes
r config set auto-aof-rewrite-percentage 0 ; # Disable auto-rewrite.
waitForBgrewriteaof r
r propagate-test-2
r propagate-test-3
r multi
r propagate-test-2
r propagate-test-3
r exec
# Load the AOF
r debug loadaof
assert_equal [s 0 unexpected_error_replies] 0
}
}
}
+72
View File
@@ -320,4 +320,76 @@ start_server {tags {"multi"}} {
$rd close
r ping
} {PONG}
test {MULTI and script timeout} {
# check that if MULTI arrives during timeout, it is either refused, or
# allowed to pass, and we don't end up executing half of the transaction
set rd1 [redis_deferring_client]
set rd2 [redis_deferring_client]
r config set lua-time-limit 10
r set xx 1
$rd1 eval {while true do end} 0
after 200
catch { $rd2 multi; $rd2 read } e
catch { $rd2 incr xx; $rd2 read } e
r script kill
after 200 ; # Give some time to Lua to call the hook again...
catch { $rd2 incr xx; $rd2 read } e
catch { $rd2 exec; $rd2 read } e
set xx [r get xx]
# make sure that either the whole transcation passed or none of it (we actually expect none)
assert { $xx == 1 || $xx == 3}
# check that the connection is no longer in multi state
$rd2 ping asdf
set pong [$rd2 read]
assert_equal $pong "asdf"
}
test {EXEC and script timeout} {
# check that if EXEC arrives during timeout, we don't end up executing
# half of the transaction, and also that we exit the multi state
set rd1 [redis_deferring_client]
set rd2 [redis_deferring_client]
r config set lua-time-limit 10
r set xx 1
catch { $rd2 multi; $rd2 read } e
catch { $rd2 incr xx; $rd2 read } e
$rd1 eval {while true do end} 0
after 200
catch { $rd2 incr xx; $rd2 read } e
catch { $rd2 exec; $rd2 read } e
r script kill
after 200 ; # Give some time to Lua to call the hook again...
set xx [r get xx]
# make sure that either the whole transcation passed or none of it (we actually expect none)
assert { $xx == 1 || $xx == 3}
# check that the connection is no longer in multi state
$rd2 ping asdf
set pong [$rd2 read]
assert_equal $pong "asdf"
}
test {MULTI-EXEC body and script timeout} {
# check that we don't run an imcomplete transaction due to some commands
# arriving during busy script
set rd1 [redis_deferring_client]
set rd2 [redis_deferring_client]
r config set lua-time-limit 10
r set xx 1
catch { $rd2 multi; $rd2 read } e
catch { $rd2 incr xx; $rd2 read } e
$rd1 eval {while true do end} 0
after 200
catch { $rd2 incr xx; $rd2 read } e
r script kill
after 200 ; # Give some time to Lua to call the hook again...
catch { $rd2 exec; $rd2 read } e
set xx [r get xx]
# make sure that either the whole transcation passed or none of it (we actually expect none)
assert { $xx == 1 || $xx == 3}
# check that the connection is no longer in multi state
$rd2 ping asdf
set pong [$rd2 read]
assert_equal $pong "asdf"
}
}
+16
View File
@@ -146,6 +146,17 @@ start_server {tags {"scripting"}} {
set e
} {*not allowed*}
test {EVAL - Scripts can't run XREAD and XREADGROUP with BLOCK option} {
r del s
r xgroup create s g $ MKSTREAM
set res [r eval {return redis.pcall('xread','STREAMS','s','$')} 1 s]
assert {$res eq {}}
assert_error "*xread command is not allowed with BLOCK option from scripts" {r eval {return redis.pcall('xread','BLOCK',0,'STREAMS','s','$')} 1 s}
set res [r eval {return redis.pcall('xreadgroup','group','g','c','STREAMS','s','>')} 1 s]
assert {$res eq {}}
assert_error "*xreadgroup command is not allowed with BLOCK option from scripts" {r eval {return redis.pcall('xreadgroup','group','g','c','BLOCK',0,'STREAMS','s','>')} 1 s}
}
test {EVAL - Scripts can't run certain commands} {
set e {}
r debug lua-always-replicate-commands 0
@@ -741,3 +752,8 @@ start_server {tags {"scripting repl"}} {
}
}
start_server {tags {"scripting"}} {
r script debug sync
r eval {return 'hello'} 0
r eval {return 'hello'} 0
}
+66
View File
@@ -0,0 +1,66 @@
start_server {tags {"tracking"}} {
# Create a deferred client we'll use to redirect invalidation
# messages to.
set rd1 [redis_deferring_client]
$rd1 client id
set redir [$rd1 read]
$rd1 subscribe __redis__:invalidate
$rd1 read ; # Consume the SUBSCRIBE reply.
test {Clients are able to enable tracking and redirect it} {
r CLIENT TRACKING on REDIRECT $redir
} {*OK}
test {The other connection is able to get invalidations} {
r SET a 1
r GET a
r INCR a
r INCR b ; # This key should not be notified, since it wasn't fetched.
set keys [lindex [$rd1 read] 2]
assert {[llength $keys] == 1}
assert {[lindex $keys 0] eq {a}}
}
test {The client is now able to disable tracking} {
# Make sure to add a few more keys in the tracking list
# so that we can check for leaks, as a side effect.
r MGET a b c d e f g
r CLIENT TRACKING off
}
test {Clients can enable the BCAST mode with the empty prefix} {
r CLIENT TRACKING on BCAST REDIRECT $redir
} {*OK*}
test {The connection gets invalidation messages about all the keys} {
r MSET a 1 b 2 c 3
set keys [lsort [lindex [$rd1 read] 2]]
assert {$keys eq {a b c}}
}
test {Clients can enable the BCAST mode with prefixes} {
r CLIENT TRACKING off
r CLIENT TRACKING on BCAST REDIRECT $redir PREFIX a: PREFIX b:
r MULTI
r INCR a:1
r INCR a:2
r INCR b:1
r INCR b:2
r EXEC
# Because of the internals, we know we are going to receive
# two separated notifications for the two different prefixes.
set keys1 [lsort [lindex [$rd1 read] 2]]
set keys2 [lsort [lindex [$rd1 read] 2]]
set keys [lsort [list {*}$keys1 {*}$keys2]]
assert {$keys eq {a:1 a:2 b:1 b:2}}
}
test {Adding prefixes to BCAST mode works} {
r CLIENT TRACKING on BCAST REDIRECT $redir PREFIX c:
r INCR c:1234
set keys [lsort [lindex [$rd1 read] 2]]
assert {$keys eq {c:1234}}
}
$rd1 close
}
+7
View File
@@ -390,6 +390,13 @@ start_server {tags {"hash"}} {
lappend rv [string match "ERR*not*float*" $bigerr]
} {1 1}
test {HINCRBYFLOAT fails against hash value that contains a null-terminator in the middle} {
r hset h f "1\x002"
catch {r hincrbyfloat h f 1} err
set rv {}
lappend rv [string match "ERR*not*float*" $err]
} {1}
test {HSTRLEN against the small hash} {
set err {}
foreach k [array names smallhash *] {
+7
View File
@@ -151,4 +151,11 @@ start_server {tags {"incr"}} {
catch {r incrbyfloat foo 1} err
format $err
} {ERR*valid*}
test {No negative zero} {
r del foo
r incrbyfloat foo [expr double(1)/41]
r incrbyfloat foo [expr double(-1)/41]
r get foo
} {0}
}
+69
View File
@@ -93,6 +93,18 @@ start_server {
assert {[r XACK mystream mygroup $id1 $id2] eq 1}
}
test {XACK should fail if got at least one invalid ID} {
r del mystream
r xgroup create s g $ MKSTREAM
r xadd s * f1 v1
set c [llength [lindex [r xreadgroup group g c streams s >] 0 1]]
assert {$c == 1}
set pending [r xpending s g - + 10 c]
set id1 [lindex $pending 0 0]
assert_error "*Invalid stream ID specified*" {r xack s g $id1 invalid-id}
assert {[r xack s g $id1] eq 1}
}
test {PEL NACK reassignment after XGROUP SETID event} {
r del events
r xadd events * f1 v1
@@ -147,6 +159,50 @@ start_server {
assert {[lindex $res 0 1 1] == {2-0 {field1 B}}}
}
test {Blocking XREADGROUP will not reply with an empty array} {
r del mystream
r XGROUP CREATE mystream mygroup $ MKSTREAM
r XADD mystream 666 f v
set res [r XREADGROUP GROUP mygroup Alice BLOCK 10 STREAMS mystream ">"]
assert {[lindex $res 0 1 0] == {666-0 {f v}}}
r XADD mystream 667 f2 v2
r XDEL mystream 667
set rd [redis_deferring_client]
$rd XREADGROUP GROUP mygroup Alice BLOCK 10 STREAMS mystream ">"
after 20
assert {[$rd read] == {}} ;# before the fix, client didn't even block, but was served synchronously with {mystream {}}
}
test {XGROUP DESTROY should unblock XREADGROUP with -NOGROUP} {
r del mystream
r XGROUP CREATE mystream mygroup $ MKSTREAM
set rd [redis_deferring_client]
$rd XREADGROUP GROUP mygroup Alice BLOCK 100 STREAMS mystream ">"
r XGROUP DESTROY mystream mygroup
assert_error "*NOGROUP*" {$rd read}
}
test {RENAME can unblock XREADGROUP with data} {
r del mystream
r XGROUP CREATE mystream mygroup $ MKSTREAM
set rd [redis_deferring_client]
$rd XREADGROUP GROUP mygroup Alice BLOCK 0 STREAMS mystream ">"
r XGROUP CREATE mystream2 mygroup $ MKSTREAM
r XADD mystream2 100 f1 v1
r RENAME mystream2 mystream
assert_equal "{mystream {{100-0 {f1 v1}}}}" [$rd read] ;# mystream2 had mygroup before RENAME
}
test {RENAME can unblock XREADGROUP with -NOGROUP} {
r del mystream
r XGROUP CREATE mystream mygroup $ MKSTREAM
set rd [redis_deferring_client]
$rd XREADGROUP GROUP mygroup Alice BLOCK 0 STREAMS mystream ">"
r XADD mystream2 100 f1 v1
r RENAME mystream2 mystream
assert_error "*NOGROUP*" {$rd read} ;# mystream2 didn't have mygroup before RENAME
}
test {XCLAIM can claim PEL items from another consumer} {
# Add 3 items into the stream, and create a consumer group
r del mystream
@@ -288,4 +344,17 @@ start_server {
}
}
}
start_server {tags {"stream"} overrides {appendonly yes aof-use-rdb-preamble no}} {
test {Empty stream with no lastid can be rewrite into AOF correctly} {
r XGROUP CREATE mystream group-name $ MKSTREAM
assert {[dict get [r xinfo stream mystream] length] == 0}
set grpinfo [r xinfo groups mystream]
r bgrewriteaof
waitForBgrewriteaof r
r debug loadaof
assert {[dict get [r xinfo stream mystream] length] == 0}
assert {[r xinfo groups mystream] == $grpinfo}
}
}
}
+38
View File
@@ -191,6 +191,17 @@ start_server {
assert {[lindex $res 0 1 0 1] eq {old abcd1234}}
}
test {Blocking XREAD will not reply with an empty array} {
r del s1
r XADD s1 666 f v
r XADD s1 667 f2 v2
r XDEL s1 667
set rd [redis_deferring_client]
$rd XREAD BLOCK 10 STREAMS s1 666
after 20
assert {[$rd read] == {}} ;# before the fix, client didn't even block, but was served synchronously with {s1 {}}
}
test "XREAD: XADD + DEL should not awake client" {
set rd [redis_deferring_client]
r del s1
@@ -328,6 +339,33 @@ start_server {
assert_equal [r xrevrange teststream2 1234567891245 -] {{1234567891240-0 {key1 value2}} {1234567891230-0 {key1 value1}}}
}
test {XREAD streamID edge (no-blocking)} {
r del x
r XADD x 1-1 f v
r XADD x 1-18446744073709551615 f v
r XADD x 2-1 f v
set res [r XREAD BLOCK 0 STREAMS x 1-18446744073709551615]
assert {[lindex $res 0 1 0] == {2-1 {f v}}}
}
test {XREAD streamID edge (blocking)} {
r del x
set rd [redis_deferring_client]
$rd XREAD BLOCK 0 STREAMS x 1-18446744073709551615
r XADD x 1-1 f v
r XADD x 1-18446744073709551615 f v
r XADD x 2-1 f v
set res [$rd read]
assert {[lindex $res 0 1 0] == {2-1 {f v}}}
}
test {XADD streamID edge} {
r del x
r XADD x 2577343934890-18446744073709551615 f v ;# we need the timestamp to be in the future
r XADD x * f2 v2
assert_equal [r XRANGE x - +] {{2577343934890-18446744073709551615 {f v}} {2577343934891-0 {f2 v2}}}
}
}
start_server {tags {"stream"} overrides {appendonly yes}} {
+30
View File
@@ -419,4 +419,34 @@ start_server {tags {"string"}} {
r set foo bar
r getrange foo 0 4294967297
} {bar}
set rna1 {CACCTTCCCAGGTAACAAACCAACCAACTTTCGATCTCTTGTAGATCTGTTCTCTAAACGAACTTTAAAATCTGTGTGGCTGTCACTCGGCTGCATGCTTAGTGCACTCACGCAGTATAATTAATAACTAATTACTGTCGTTGACAGGACACGAGTAACTCGTCTATCTTCTGCAGGCTGCTTACGGTTTCGTCCGTGTTGCAGCCGATCATCAGCACATCTAGGTTTCGTCCGGGTGTG}
set rna2 {ATTAAAGGTTTATACCTTCCCAGGTAACAAACCAACCAACTTTCGATCTCTTGTAGATCTGTTCTCTAAACGAACTTTAAAATCTGTGTGGCTGTCACTCGGCTGCATGCTTAGTGCACTCACGCAGTATAATTAATAACTAATTACTGTCGTTGACAGGACACGAGTAACTCGTCTATCTTCTGCAGGCTGCTTACGGTTTCGTCCGTGTTGCAGCCGATCATCAGCACATCTAGGTTT}
set rnalcs {ACCTTCCCAGGTAACAAACCAACCAACTTTCGATCTCTTGTAGATCTGTTCTCTAAACGAACTTTAAAATCTGTGTGGCTGTCACTCGGCTGCATGCTTAGTGCACTCACGCAGTATAATTAATAACTAATTACTGTCGTTGACAGGACACGAGTAACTCGTCTATCTTCTGCAGGCTGCTTACGGTTTCGTCCGTGTTGCAGCCGATCATCAGCACATCTAGGTTT}
test {LCS string output with STRINGS option} {
r LCS STRINGS $rna1 $rna2
} $rnalcs
test {LCS len} {
r LCS LEN STRINGS $rna1 $rna2
} [string length $rnalcs]
test {LCS with KEYS option} {
r set virus1 $rna1
r set virus2 $rna2
r LCS KEYS virus1 virus2
} $rnalcs
test {LCS indexes} {
dict get [r LCS IDX KEYS virus1 virus2] matches
} {{{238 238} {239 239}} {{236 236} {238 238}} {{229 230} {236 237}} {{224 224} {235 235}} {{1 222} {13 234}}}
test {LCS indexes with match len} {
dict get [r LCS IDX KEYS virus1 virus2 WITHMATCHLEN] matches
} {{{238 238} {239 239} 1} {{236 236} {238 238} 1} {{229 230} {236 237} 2} {{224 224} {235 235} 1} {{1 222} {13 234} 222}}
test {LCS indexes with match len and minimum match len} {
dict get [r LCS IDX KEYS virus1 virus2 WITHMATCHLEN MINMATCHLEN 5] matches
} {{{1 222} {13 234} 222}}
}